From NetEase:
Shanghai “Black girl” Lou Jing becomes famous on the internet
Lou Jing [shown with mother above], who participated in DragonTV’s “Jia you! Oriental Angels“, recently became exceptionally popular on the internet, having been cursed to fame by netizens! Lou Jing was viciously abused owning to her life experience. Many netizens learned that Lou Jing was born after her married mother had [extra-marital] relations with a black man, and let loose a torrent of abuse on the internet. August 30, Lou Jing issued on the internet a stern but fair protest against netizens’ racism, that the color of her skin should not become a target of attack. At the same time, she also said she reserved the right to take legal action.
From KDS:
Shanghai’s most green [cuckolded] man, whose wife gives birth to a black man’s child~~
Lou Jing’s mother had a husband, then had an extramarital affair with a black man, then gave birth to Lou Jing, and then after her birth divorced.
And that black devil, after fucking ran back to his home in Africa.
It is unimaginable how that Shanghainese man [husband], excited and anxious to see his own “daughter”, must have felt when he saw that she was black…
A response by Lou Jing on KDS:
I am DragonTV Angel Lou Jing, and here I make a statement!
- My father is American, not African.
- I am a born and bred Shanghainese person.
- I should not have to bear my parents’ mistake, I am innocent!
- Sternly but strongly protest some people’s racism, my skin color should not become a target of attack!
I reserve the right to take legal action!
Comments from KDS:
hsxxl:
Would this be a green hat or a black hat?
看低2800点:
Her mom really knows how to enjoy herself
erick:
Even going on television…what is this show trying to promote? Extra-marital affairs…?
sara:
This mother is really horny.
Jesse_Q:
Her mother’s skin is pretty thick.
At the time finding foreigners was indeed a fad, but you still can’t pick blacks!
滢滢:
Kao.
Fucked by a black.
How come a zebra wasn’t born…?
黑丫子:
Ugh. Yellow people and black people mixed together is very gross…only black skin, not yellow skin, chocolate skin…
Not even knowing this common knowledge, ruining a child’s life.
Lyna:
There are still a lot of this kind of women that would get involved with blacks~
Her old mother at the time had courage, probably also did not know what color would she would give birth to, white, yellow, all possible, right…?
K-I:
She does not have it easy either.
She’s still better than those men and women these days who treat abortion like a trivial matter.
Moreover, her mother was not married.
If the men in this post are all so enthusiastic about attacking her,
then you guys better take care of your own lives.
小艾Deryck:
Can that black person’s home see DragonTV? …
篮球暴男:
Numb! This bitch still has the audacity to appear on television! I don’t know what to say! One cannot be shameless to this kind of level!
手刹车:
Black people actually have a pretty high standing internationally, many famous fashion models and stars are all married to black people.
However in China, this kind of thing is a little embarrassing/shameful.
Bblueye:
I think this mother is still very great/admirable.
Willing to face her own mistakes, I ask how many TF here would dare to face [such mistakes].
A single mother able to bring up a daughter is already very difficult/impressive, much less one with a different skin color, the difficulties are imaginable.
Everyone has the ability to analyze what is right, what is wrong. Everyone think about it, don’t be so immature, opening your mouth to hurl abuse without thinking. Be a bit more understanding with other people.
伐要弄管:
I think Lou Jing should not be condemned, she herself did nothing wrong, and if her father was an American white person, she probably would not be discriminated against. In the end, it is still racism.
包龙星:
Black people’s tools/weapons are big! Her mother must have been very satisfied! Even having the audacity to go on television! Probably hoping that Africa can see [the television show], and [the father] will come to recognize his daughter, haha!
另壺蔥:
But you guys should not forget…black women’s bodies are the best in the world…
The modeling industry and entertainment industry all have a lot of black women…
一天又一天:
There is news saying that black person is T-MAC’s [Tracy McGraw, NBA player] cousin.
向日葵皇帝:
Obama’s little sister.
Similarities: Male black dog x different skin colored woman.
Differences: Black x White = Obama, Black x Yellow = Luo Jing.
Comments from Tianya:
jiyangjiang:
Having this kind of woman as a mother, truly lamentable.
老实人春生:
There is nothing wrong with the daughter, but her mother is indeed a bitch/slut, married but still getting involved with a black person, probably for the great “love” too. Too bad the black man treated her as a toy. Chinese girls, please have a little more self-respect.
波小斯:
The television channel is also shameless, using this kind of thing to hype/promote/attract attention [to itself].
I imagine her mother is also feeling helpless, bringing out and talking about such a shameful past, and ultimately [in hopes of helping] her daughter.
Miss_Q:
I cannot help but say, those coming out of mixing yellow and black blood are all truly ugly, a dirty feeling [appearance]…
phoenix81:
I do not know why,
but after seeing these photographs, my mind is reminded of Japanese-made adult videos, with the final climax scene of the black man, where the black man’s muscular body tightly pressed on the Japanese woman’s white and tender skin, pulling out after shuddering from climax, and then so many seconds of close-up — of vaginal liquids and semen everywhere.One or several times N years ago, this Lou Jing’s mother along with a black person also played out such a scene.
This black man’s daughter is truly deserving of pity. The mistake is not on her, but on her mother’s and that black biological father.
GOLAKER1:
Girls, you guys should know that even in America, which represents the highest level of black people, 60% of black children are brought up by their mothers alone. Do you understand what this means?
It means the men all fucked and ran, not taking responsibility for anything! There are often black people who have had children with over 10 different women, that American netizens all ask that they be castrated…
藍天白雲輕風:
When I first saw this week’s show, I too was very shocked, so stunned. Society’s norms and values haven’t becomes so “fei zhu liu“, has it? As a post-80s generation, I completely cannot accept this. If I were that girl, I would be so low key that I could not be any more low key. How could I possibly come out and expose my face, seeking attention and sympathy…it is difficult to understand.
美女也爱国:
How much self-respect could the child of a shameless old woman be?
And she still wants to find her American father. Who knows if her father is in jail for being unable to repay his loans or dead from a gun fight on the streets.
Judging by her mother’s story, it seems like her mother was not very familiar with her American black father anyway, so trying to find…America’s already has a bunch of black children trying to find their own biological fathers.
yimihai:
I am not racist, but if her mother really was married first and got involved with a black person, then that is indeed low. What more, not knowing to use contraceptives or abortion, could she have really been thinking of using a child to tie down a foreigner? Truly both low and deplorable.
The child is innocent…
090902 UPDATE: Here is a video of Lou Jing:
Related Posts:
- Chinese netizens comment on a rare Chinese male, black female couple photographed on the Shanghai Metro. Some joke that Chinese men cannot possibly satisfy her. » 230 comments
- Chinese netizens reactions to a Chinese female & black male couple found naked and fooling around publicly while underground rafting at an scenic/tourist area. » 344 comments
- A 3-year-old Yunnan Chinese girl is in the hospital after suffering long-term child abuse living with her aunt while her parents were away working to make money. » 70 comments
- Shanghainese girl posts a photo of an overweight Taiwanese girl getting married, asks how come she herself is still single. Netizens wonder: money or true love? » 85 comments
- Young Chinese girl meets 18-year-old young man on internet, soon forced to stay with him for over a year. Judge blames parents for not teaching her properly. » 107 comments




Com’on – there’s just no sense at all to that stupid topic.
Having a cheating wife sux – doesn’t matter if the fucker is black, white, pink, whatever ;p
DAmn!!!! how could you be so right, PONTI!
i hope u r from china or shangai cause u seem to have a clear mind and seem to be one of the rare healthy person of this website.
Why chinese dislike like this black people?
I am an Afican American/black woman.
I am glad that I had a chance to read the comments that Chinese people made on this web page.
First, let me explain that I do not think that racism is wrong. I believe that bigotry is wrong. Chinese people have a right to keep their race pure.
It is shame that black people do not think like people from Asia and the Middle East. Jews, Arabs, Indians, Chinese, Pakastanis, all are homogenous and believe in marrying, breeding and keeping financial matters within their respective clans.
While I am very hurt that so many Chinese people on this post see black people as animals, I am also glad that I saw enough proof of their hatred for black people that you will never see me in a Chinese restaurant again.
I have a $100,000,000.00 lawsuit (please visit http://www.thecrimesofsenatoruzamere.com/lawsuit_for_fraud.html for more information). If I ever win that money, you can best believe that I will use my last breath to create a little community of blacks who don’t mix with Asians and Middle Easterners who hate us and see us as black, ugly “lo fah.”
Ahhhh, a purely black neighborhood where even the sushi and lo mein are made by black people…a neighborhood where I never have to run into Chinese people who hate me…I can even print this site and pass it around to the blacks who still stupidly go to buy Chinese food.
I know it’s a stupid dream…but I can dream, can’t I?
Although you are clearly upset, and you have the right to be, your comment is just as ignorant and racist as the negative comments people are posting about Lou Jing.
There are many chinese people who do not feel this way about blacks and are actually open-minded enough to not feel this way. Your comments about creating a “community of blacks” and boycotting chinese food just shows how you are stereo-typing all chinese.
The treatment Lou Jing is getting is obviously wrong and many of us believe this and support her in her endeavors. You say that you will not go to any more chinese restaurants, and what about other chinese businesses? Your association with chinese people and chinese food only shows how ignorant you are. Chinese people are not ONLY GOOD for making chinese food. For you to call out not only chinese people, but all “middle easterns” and grouping everyone together is not only racist but a fine example of why this world will always stay the way it is–filled with hatred and retaliation rather than understanding.
If you want to make a comment or express your feelings, please do not stereotype. When you do, people stop listening, realizing that you are only furthering the racism that fueled this in the first place. I wish I can respect your comment and opinion, but because of the ways you have stated them, I cannot support them or even say I understand where you are coming (although I have experienced racism many times).
Your “dream” is one of a world that is segregated. Neighborhoods that are “purely black” or white or chinese, etc. would erase all of the historical and social changes that the few courageous men and women have contributed to our societies. I forever hope that this dream of yours will be just that–a dream.
The Problem is that Chinese like most Asians are totally ignorant when it comes to race. Sure, we should all be proud of our racial heritage and culture, having said that. As an Black American who has a biracial child, I know my daughter is beautiful. There is nothing wrong with being Black, White or Asian for that matter. What it boils down to is jealousy. Most Asians are small-minded thinking when it come to race and Blacks in particular. We are are equal. NO asian person would or could ever make me feel inferior, in fact, I laugh at them, because it shows their own pathetic insecurity. How does skin color equate ones intelligence?
So if you are blind and a Chinese person and a Black and White person were in the same room and had to touch each other, there is no way you could ever tell who is who! What makes White skin better? That makes you a better Homo Sapien?
Chinese people hate themselves, it’s a known fact, because if they didn’t, then why do they have to bleach, change their breasts, nose, cheeks etc.? For what? A confident individual would never want to do that. I can see if it is a life-threatening problem, but on the level that Chinese do it and think that the White community will accept them, is so over the top ludicrous! I would never, ever, ever want to be Asian or White. I thank God everyday for making me, me. I love myself a lot. I never hold my head down and have the utter most confidence, because if someone that doesn’t like me because of my color, then that means, they fear me. And that feels good. Stereotypes are sometimes overrated and should not be taken seriously, you good people in every race, but a Black heart, and Asian heart are all the same, if you do an organ transplant, no ever asks, “from which race did this organ come from?” It doesn’t matter. We are all coming together faster than we can think and if China, the growing superpower wants to act in a real sincere and responsible way, then that means, they also need to grow up and understand, the world comes in different colors and races and religions and it’s Ok to be different and that one race is not superior to another. Because if you think that, then that makes you the lowest and most ignorant person, period! I hope more people mix and become one, that way, all this foolishness will stop, but on that point, many Asian countries are still adolescent in that regard. One thing is for sure, when we die, we all go back to being the same….dirt!
Cheryl don’t be discouraged. China Smack basically cherry picked the few bad comments to make the story more than it is.
I found these comments from the same KDS thread China Smack cited. There are LOTS of comments supportive of Lou, and against racism. I really don’t know why they are left out:
“不要去歧视外地的,大家都是平等的” – don’t discriminate against outsiders, everyone is equal
“小黑是无辜的” – Little Black [Lou Jing's nickname] is innocent
“这个小姑娘是无辜的,大家积点口德” – the little lady is innocent, everyone watch what they’re saying
“我觉得这个母亲还是很伟大的” – I feel Mother Lou is quite admirable
“小孩很可怜从小被歧视” – poor girl’s been discriminated since little
“以后碰到你身上 你还能噶笃定” – wait til it happens to you, will you be so self righteous
“单身母亲还是要理解的” – single mothers need understanding
“小孩没什么错,大家别这么刻薄” – kids are never wrong, everyone stop being so harsh
“大家不用这么说人家小姑娘吧” – people, there’s no need to talk about her like this
“怎么说她也是讲上海话的土生土长的上海人” – no matter what, she is a local born and raised shanghainese
“何必要这么搞臭人家呢” – why poopoo others like this?
[Note from Fauna: Please do not continue to post comments with different names.]
are you an idiot??? you definitely sound like one.
It’s people like you that keep the black community down and the world in general.
Become enlightened.
Hi everybody,
I just want to say that I didn’t know Chinese were so racists. I’m an African girl who lives in Belgium: I have never seen so many insults on black people in my entire life!!
So what? You think you are better than us?
Just look at your country where you can’t say what you’re want about the government! You are slaves of your president or whatever and his guys..
Many of your people work for almost nothing, you have children who don’t go to school…
You’re think you are better? More beautiful? Come on! Just stop dreaming: if there is a quizz with Black women and Chinese women in all over the world, I bet black women would win…. Don’t misunderstood: before I read all the bullshits I wasn’t thinking of that, but know….
Oh and yes, do you think Black people like you that much? Are you kidding? Just continue to be racist in your country beacause all of you who live in the USA: You have a Black man as presiden, how does it feeLS?
Sorry, but I can’t let it go…
I have to at least write something…
that’s stupid. world peace guys! we’re all human! i have lots of chinese friends and black and white friends. but duh! we live peacefully people. this topic just sucks. what is about anyways? it’s not about the girl being a mixed chinese and black, it’s about being married and having an extra marital affair. There’s nothing wrong with being a mixed. nothing wrong with being a black. i’m mixed black but so what? my friends love me and that’s it. we can co’exist peacefully guys. just “R E S P E C T” for everyone. and may God bless us all.
hi cheryl!i agree with u,i am a filipina who have a black babygirl,she is 4 months old now,i was very hurt to about those comments of this crazy and truly ugly chinese.I know and we know that chinese are very low profile in the world,they have no right to criticize black people because we all know that blacks are talented,wise and ver powerful human.I love my child and his father very much,from now on I HATE CHINESE.
*I’m a black American woman*
Oh,thank goodness for saying that CHERYL D.UZAMERE.
What a relief it is that ’someone’ gets it.Someone not willfully ignorant.
I 100% agree that every other community has a goal of self sustenance.That is,of course,except the black community.I can only respect those communities for doing what anyone would do on the prudent principle to insure stability & survival of their group.
Blacks have this thing of constantly placing themselves in a position that necessitates they beg for acceptance.
You should never operate on these grounds.
After all,that is what autonomy is all about.External factors should never be allowed to dictate that groups well being.
To blacks:Get with the program! You’re the only exception.
owkay..this is funny..*corz i’m being sarcastic.haha
it’s just that, there are billions of chinese in the world and maybe 50 or 60% of them are the likes of chinese here who are racists…but dont u think it’s unfair to the other percentage of chinese who are not racist?? hello people.. it doesnt matter what other people think..it’s what “WE” think that matters.. these kinds of thinking starts war. tsk. if this continue, we’ll be expecting another world war in the near future.
I don’t care if you inderstand: I’m just angry!!
C’est quoi ces attaques racistes?
NOn, mais je rêve: vous avec vos pauvres vies, à cause de la souffrance que vous avez causés à cette fille et à sa mère, vous serez jugés!!! Et j’espère que vous aurez l’occasion d’aller rencontrer votre père adoré- le diable- en enfer… Il vous accueillera les bras ouverts…
Vos blagues sont pourries, sans compter le fait que les chintocs n’ont rien de bien spécial ) part un pays qui prend de la place pour rien!!!
Continuez à nous fournir des marchandises à bas prix et des films de combat et fermez-la.
Peu importe ce que vous pourrez faire, vous n’aurez jamais le prestige d’être respecté. Vous garderez toujours votre imege de mains d’oeuvre à bas prix!!
bet the -1 was because they dont understand french HAHAHAHAHAHAHAHA
obviousy because blacks have a bigger *********, hahaha im joking…. no joke…. Chinese are like this against any other race
@ NELLA: girl, you made me laugh so much with your post… The people must be feeling so enraged right now of all the things you said that are true
I agree. Chinese arent racist. They are like me, just hate everyone. HAhahaha…
There is nothing about the racism. It’s her shameless and irresponsible mother. Before she gave birth to her daughter, she probably did not know who the baby’s father was. Had the girl have normal Chinese color, the mother would have continued her cheating practice. She was nothing but a tasteless, cheap and stupid prostitute. I just wonder how much money she got. Now she shows up on TV without covering her face. She is truely a “thick faced” slut. The whole nation, especially Shanghai, has been insulted by her dirt.
So why care about her past? Have you not made any mistakes in your entire life? You might be even worse when you are alone or u might have done the worst things when faced similar situations during her time.
You dont hae the right to judge her.
Are you sure your comments have really nothing to do about the race?
y all the self righteousness. you are here insulting others, who knows what you are doing behind closed doors. oh please, get a life and leave the mother alone.
Dearest jing jing
Yellow skin in not, I repeat, not normal color. Asians are the only race on the planet with yellow skin. Now that is far from normal colored skin. Yes I agree, her mother single handedly brought shame to shanghai, which is world renowned for it’s poverty, dirty streets, prostitution, child slavery and curruption.
I can see how this young girl could be such a change from normal.
Afa, The African,
I PROPOSE THAT, FOR LOVE PEASE AND HARMONY OF THIS CHINA NETIZEN AND FOR ETHNIC LOVE AND UNITY, WE END ALL THESE RANCOR AND DISTRUST OF EACH OTHER, BY SETTING UP A LOU JING EDUCATION FUND DRIVE, TO ENABLE HER AND HER MOTHER TO UNDERSTAND THAT, WHAT EVER THEIR SITUATION WE LOVE THEM, THE WORLD LOVES THEM AND MOST IMPORTANTLY, GOD LOVES THEM VERY MUCH INSPITE OF WHAT PEOPLE MAY THINK OR SAY.
IF YOU KNOW HOW THIS CAN BE ARCHIEVED, PLEASE LET ME KNOW. OR IF YOU KNOW THE CORRECT WAY TO SET THIS FUND DRIVE SO IT CAN REACH LOU JING AND HER MOTHER, PLEASE POST OR EMAIL ME THROUGH CHINASMACK
GOD HAS HIS WAY OF SENDING HIS MESSAGE TO US MERE MORTALS.
I LOVE CHINESE PEOPLE.
LOVE, PEASE, HARMONY,
THANKS TO EVERYONE
Afa, The African
You people are a complete disgrace , you have Chinese people working in all parts of Africa statements like the above would put Chinese works in Africa in danger, This girl is Goods creation more importantly she is very beautiful
my dear not only are they working in africa but also marrying and having uncontrolled sex with african women and producing half orientals everywhere. i am also from a homogeneous society and when we see their seed we can spot them.
Its 2009, grow up people things happen in life and love and she is here and she breath’s and has feelings, hold your head up Lou and be proud of your heritage, I am glad you grace our planet and I must say you are simply stunning!
I AM SO SICK OF THIS!
I only know a few truely wonderful chinese people!!
Everyone else is so damn racist and ignorant.
I defend the chinese, I respect them and learn the language.AND TO HEAR IM DIRTY AND SUCH BAD THINGS.
You people on this site are shameless bastards and your families should be ashamed to have such coldhearted, stupid, hateful children.
You disgrace all human for you retard remarks.
Just like chinese have bad chinese people. Black people and bad black people. Because we don’t have your fake ass pure white skin dont shame us!!
Im beautiful, and so is lou jing!!! Her mother cheated on her husband probably because he was a mean bastard and didnt respect her, so he found someone she though that did.She was wrong and made a mistake but she got a beautiful daughter in return.
So fuck you racist bastards!
mwah bless you sister.
To all you SICK RASCIST CHINESE YOUR THE MOST PITIFUL NATION IN THE WORLD!!!!. One of the oldest civilizations in the world and the BEST THATS IN ALL OF U Is ::::dont have sex with black men..Are you telling me there are 1 billion rascist Chinese people ??? then all of U deserve the poverty and the Pain your going through with your government..All of U should never leave the borders of China and RUN TO MY COUNTRY!!! you all make me sick to my stomach thats why you people suffer so much its KARMA…She should come to the greatest and most powerful nation on earth thats where she belongs…not be with you fucked up little people ..Instead of seeing the beauty in it you worthless assholes see color….WELLL HERE IS A SURPRISE FOR U DUMB ASSHOLES THE ORIGINAL MAN IS BLACK!!!! CHECK IT READ IT WRITE IT AND ENJOY IT AND YES!!!!! ALL OF U TOO!!! SO U DUMB ASSES ARE HATING ON YOURSELVES AND THATS WHY YOUR PITIFUL!!!!
Worst part is black ppl have little to claim. Very little contributions to mankind. When that changes, maybe the world will respect blacks.
Sorry but being the first man doesn’t quite cut it. It’s like saying “We invented fire”. So f-ing what!
Once blacks make a contribution to the world, racism against them will end.
In the meantime we can enjoy watching national geographic show pictures of caveman African tribes, hungry children covered in dirt and a continent in waste.
anon-it-most, Clearly you are an obvious empty headed, hence I am not going to spend mush time on you. I’ll give you a sneak preview though, take a read at this:
“Black minds have been inventors, engineers and master-builders since
antiquity. We must maintain the time-honored tradition in preparation for the
21st century and beyond.” – B.L. Crudup, P.E.
http://www.users.fast.net/~blc/xlhome2.htm
Honoring Black Inventors of the Past
Granville T. Woods – The “Black Edison.”
Lewis H. Latimer – The Man Who Made Electric Lighting Practical.
Elijah McCoy – “The Real McCoy.”
Garrett Morgan – “Father of the Gas Mask.”
Frederick Jones – Made Mobile Refrigeration Possible.
http://www.diabeticseniors.com/cure-diabetes-found-nigeria/
“It’s official – a Nigerian scientist, Dr. Louis Obyo Obyo Nelson, has finally
found a cure for the dreaded diabetes disease which afflicts over 123 million
sufferers all over the world.
The Minister of State for Health, Dr Aliyu Idi Hong, yesterday described as
“epoch and historical” the production of Antidiabetic Phytophar-maceutical by
Nelson in collaboration with the Nigerian Pharmaceutical Research and
Development.
Dr. Nelson had been granted a United States patent entitled “Medicament for the
Treatment o Diabetes”, a feat that raised hopes for millions of sufferers of
the disease worldwide.
Nigerian scientist, Oyibo, gets honour in U.S.
YET another Nigerian is making waves in academic circles across the globe. Prof. Gabriel Oyibo, a Mathematical physicist, has advanced Albert Einstein’s relativity theory and answered questions that Einstein tried to address until he died regarding the origin of the universe.
Oyibo’s latest book is already bursting the charts and he is getting a third nomination for the Nobel Prize. A group of African Americans in Washington DC has already decided to institute a professorial chair for him at an endowed sum of $2.5 million.
For his new formula and findings, Oyibo has been nominated thrice for the Nobel Prize in Physics. A professor of Mathematics at the University of Bridgeport, Connecticut, United States (U.S.), Oyibo has also now founded a new institute for the further study, application and understanding of his findings.
His latest book, the Grand Unified Theorem, Discovery of the Theory of Everything and the Fundamental Building Block of Quantum Theory, is already bursting the science charts in the U.S.
Do you Chimp want more?…This site will not be large enough if the listing starts
Hahaha… give it to them Bronze Breeze
YOUR SO WELL READ!!! ESPECAILLY WITH REGARDS TO HISTOR…RIGHT? THAT’S WHY THE VERY THING YOUR CHEAP INGNORANT FAMOUSLY STINK MOUTH FULL OF ROTTEN TEETH, YELLOW ASS TYPED THIS JOKE OF A COMMENT ON THE VERY THING THAT WAS INVENTED BY A BLACK AMERICAN, WHO SOLD HIS INVENTION TO BILL GATES IN THE LATE 1970′S. YOU SHOULD STICK TO WHAT YOUR PEOPLE ARE GOOD AT DOING! WHICH IS LIEING TO YOURSELF ABOUT TO FEEL SUPERIOR, IN AN EFFORT TO MASK YOUR INFERRIORITY. AND STICK TO DISCOVERING NEW WAYS TO CREATE KNOCK OFFS, AND CREATING NEW WAYS TO COOK UP TASTY MEALS OF RICE, RAT, DOG AND CAT. YOU ALSO HAVE THE WORST TABLE MANNERS. YOU CHEW LIKE ANIMALS.AND YOU ALSO GRUNT WENT YOU EAT WITH YOUR HEAD DOWN THE ENTIRE TIME, ONLY TO COME UP WHEN YOU REACH FOR MORE FOOD FROM THE MAIN DISH SITTING IN FRONT OF YOU AT YOUR TABLE.
TO KNOW WHY MODERN HISTROY DOES NOT REFLECT THE VAST CONTRIBUTIONS THAT AFRICAN AMERICANS IN RECENT TIMES- IF YOUR YLEEOW ASS CAN AFFORD CABLE/HBO- I DARE YOUR SILLY WEAK YELLOW ASS TO WATCH THE MOVE ‘ SOMETHING THE LORD MADE STARING THE ACTOR MOSE DEF.BUT THEN AGAI THAT WOULD BE TO THREATENING TO THE REALITIES OF YOUR FLUNKY ASS LIFE THAT EVEN AMOUNGST OTHER ASIANS –YOU JUST DO NOT MEASURE UP. THAT IS WHY YOU CLING TO THE FANTASY THAT BLACK DENOTES INFERRIOR. YOUR THE ONLY RACE TO COMMIT SUICIDE OVER COMPLETE BULLSHIT. IT THESE VERY BLACK PEOPLE WHO LIVED AND DIES TO ALLOW YOUR YELLOW ASS BASIC RIGHTS IN THIS COUNTRY.
LET’S GET ONE VERY OBVIOUS THING STRAIGHT. ASIANS ARE ONLY MASTERS AT COPYING OFF OF THE INVENTIONS OF OTHERS. THAT IS FAR FROM BEING SUPERIOR!
hint: THOSE JAPANESE INTERNMENT CAMPS WERE NOT FILLED WITH BLACK PEOPLE, AND NOT TO LONG AGO THIS COUNTRY NUKED YOUR ASS. SO YOU JUST THINK ABOUT THAT THE NEXT TIME YOUR AT A STOP LIGHT, WHICH WAS CREATED BY A BLACK AMERICAN….. YOU YELLOW, YELLOW BELLIED BAD DRIVER!!!!!!!!!!
The caveman you look for is inside; inside you, your mam and pap, your racist village your community, the whole line of disfuction that raised you to be who you are, which is,a man suffering from acute inferiority complex, an ignorant, no good, lesser being.
May I remind you that, if we “cavemen” decide to shot our doors of natural rescourses to China today, you will all die of hunger, just in a very short span of time.
You have to be careful how you treat others in this your new found freedom of expression, because, some of us here, make decisions that might effect the relationship between China and countries in Africa.
Now that I have experienced and noticed your attitudes toward balck people/Africans, It will be defficult for me to support any business relationships between China and my country or companies in my country. I have been instrumental in supporting China’s push against Shell petrolium Co. (Petro China, to be exert)to acquire oil fields formaly owned by Shell in my country. Now I will do evrything within my powers to make it not happen.
With such pettiness and ignorance that I see hipped against one innocent beautiful girl and her loving mother, I can now conclude that China is not yet ready to move forward into the new millelium nor ready to perticipate as one of the leaders in a global family.
you fucking animal you should be of world biatch, fucking yellow stupid matherfucker still where you are dont come any close to AMERICA OR EUROPE.
son of bicth
Great information for all who have the patience and care to learn a little about the “ORIGINAL PEOPLE” I and yours forgotten ancestory.
http://www.cwo.com/~lucumi/india.html
http://www.cwo.com/~lucumi/india.html
Just copy and past on your URL
Please enjoy,
Thanks,
Afa The African.
damn china
u racist
i know right!!? fuuuuuk..
it’s insane aye? i cant believe how many racist comments are on here, who cares if shes half black/asian? she’s HOT! (but even if she wasn’t, it doesnt make any difference). AND she’s confident enough to get out there and enter a talent contest.
all of the assholes who think its ok to abuse here because of her mixed race should find something better to do with their time.
AND Cheryl D. Uzamere is just as bad. if you believe that creating a seperate society is the answer then i will tell you now, you are wrong. just because some people discriminate against you doesn’t mean everyone of that race does.
acceptance is the way forward.
just FYI:
mix asian/black/white/whatever = hot
Igat! As Chinese, I think she’s sizzling hot. Who cares what her mother did. Human emotions and relationships are complicated enough on their own. It ain’t the daughter’s fault and she can sit on my bachelor lap any time.
People need to seriously lighten up. Some of those commentators ought to consider what their comments say about themselves more than anything else about the state of the “morals” of society or what that lovely, beautiful lady should or should not feel or do.
Ye who is without sin shall cast the first stone (or some such). Or maybe bring back the revolutionary self-reflection education classes.
You took the words right out of my mouth. thank you
Phew! So glad I’m not the only one who thinks she is hot! Damn, Lou Jing!! You should be a model! Don’t let these dumbass Chinese racists get you down. Follow your dreams, and I hope the whole world gets to see more of you.
-An Indian guy.
Thank you. Finally some evidence of sanity on this crazy fucken forum.
One thing to say:
http://www.youtube.com/watch?v=VUcNxhGoaEI
you are an angel.
fuck off cant take this
as a black afro british will not take that crap
fuck you all, i will not accept
this from chinese
soo listen up
Did blacks drop bombs on Hiroshima and Nagasaki?
Did blacks murder 6,000,000 Jews in Germany?
Did blacks declare war on Vietnam?
The men in jail in China — are they black?
Bernie Madoff, the man who ripped off 5,000 people — is he black?
The
Enron scandal, the Adelphia scandal, the worldwide financial scandals
that drain thousands of people of their money — are they black?
The tongs who bring opium from China to sell in the United States — are they black?
The same tongs who force many Chinse women into prostitution in the United States — are they black?
Just thought I’d give you a few things to think about, you stupid muthafucka’
One
more thing: It is not hard to learn how to cook Chinese food. If I ever
get the money I need, there will be NO Chinese restaurant in my
neighborhood.
fuck you all
am proud to be black
Those comments are unbelievable racist and ignorant. Even though I knew most Chinese are racist towards black people I am still shocked at reading this.
The girl looks beautiful and she shouldn’t be blamed for a mistake her mother made such a long time ago.
Its important to remember that there’s racism as reaction and racism as a mode of thought. Chinese aren’t necessarily against mixed blood couples; it was the adultery that led to racist comments.
I don’t buy that distinction at all. Racism is racism, so-called “racism as reaction” betrays racist modes of thought. Obviously, the adultery is a factor in the outrage of the commenters, but so is the racial aspect, obviously.
If this girl’s mother had had an affair with another Chinese guy, would we even know about it? Would it ever have ended up on this site? Would people be saying she shouldn’t show herself in public?
These are rhetorical questions, because everyone here knows the answers,
You’ve lost me around the second corner there bro. Waaay to deep for this site me hommie. All I can think of right now is how she’s stirring me Chinese love around and around…… Oh the sweet vertigo….
You took the words out of my mouth, ChinaGeeks!
if only i could vote for you 100 times!!
Here’s an example Charles
“I am not racist, but if her mother really was married first and got involved with a black person, then that is indeed low.”
He claims that the big problem is the adultery, but why did he have to mention “black” in that sentence? (I’m always suspicious of any comment that starts “I’m not a x, but…”) I’m not with you on this one at all, I feel there’s still a long way to go before Chinese people are more accepting of African American/Canadian/etc.
I agree here that racism is the pivotal issue that entertains this story. However I can also understand the other Charles’s view that most Chinese racism is dormant unless activated by certain situations. In other words, Chinese are latent racists but are good at concealing it.
I don’t think any of this makes it look like they’re good at concealing it.
Maybe you mean, they’re racists but they remain passive aggressive about it.
Ahhh! So that’s what political correctness is for is it? “To conceal it better”. Man, da chinkies need to get themselves some of that fabulocious goodness. Very modern and scientific that, non?
Ahhh, so seems like political correctness is good for concealing racism is it. Man! Da chinkies need to get themselves some of that fabulocious goodness. Very modern and scientific, and very fashionable too, like da people in da West already do, non?
Ooopsala! Double post…me bad. Yikes!
No they are not. When living in the US, Chinese feel the freedom to be racist. If a white person and myself (black) go into the same store at the same time and the white person has 50 piercing, several tattoos, a large bag, dirty hair, and the look of a drug addict and I had on my suit from work, designer purse, well groomed hair, and perfect purse, they follow me around. I am watch often, but not the one you know may do something if you know society around you. Even after breaking out an Amex card to pay for my purchases, I am treated this way during every visit. It is just shameful. And the type of things that are said behind blacks backs in America by Chinese should be outlawed.
As far mixed Asians: Tiger Woods, Amarie, Tyson Beckford, Kamora Lee Simmons; you may have heard of them all, but if not you have heard of at least 2. What do these have in common with Lou Jing, they are beautiful. Gorgeous as gorgeous could get.
I was once engage to an Asian and it was then when I realize the undertones of racism that runs deep. His mom always yelling to where I could here “no black, “no black”. I am not surprised at all by this, I just hate that a very beautiful girl has to experience it.
accepting of Canadians?
Yeah I’m not racist either, but those Canadians they’re always talking about their Hockey, drinking their Molson, saying eh and being unable to pronounce ‘ou’. Fucken frostbacks.
Frostbacks!! That’s awesome. F*ck Molson, by the way :)
HAHAHA your douche bag!!! besides, canadians are awesome, the least racist people in the world =D and i’m not canadian…
Bollocks. What about all the comments that make no mention of the adultery and simply say things like: Ugh. Yellow people and black people mixed together is very gross.
It’s racism pure and simple. It’s not the violent, KKK burning crosses on your lawn style of racism, but the far more insidious kind that holds that black people are somehow dirty or lower than others due to the color of their skin.
I agree with you totally. The type of racism that happened, and still happens to some degree, in the US is of the type where there is some balance, where a large percentage of people who are white find it appalling and blacks have some say in matters and over time affect changes on the culture.
The racism here in China is so ingrained that people here are not even aware of it. Look at what the netizens here had to say about Condolezza Rice when she came here. Lowest forms of insult. Ignorance. Yet Chinese people will always deny that they are racist. Look at the US Olympic team and the Chinese Olympic team. Did you see one black person on the Chinese team? One white? One brown? And if China had let a black runner on the team what do you think the national response would be? ugly racist remarks like this. And further more, these poster have no shame, no ability to search themselves and make changes or grow. Pathetic.
yea
USA is soooo NOT racist towards asians or chinese people
why dont you open a book and read some history about how USA treated and still treats Asians or chinese people to this day
Would USA Olympic team allow someone who is asian?
More like you have a ton of white-black race based murders. China doesn’t.
China has China-China based murders.
Da Sherlock Holmes is in DA HOUSE, ladies and gentlemen!
Eric: The US has many asian members in their olympic team, dumbass
Eric you are such a little dick minded jerk. The U.S Olympic team is amongst the most diverse in the world. You would like to point out how America treat china. Just look at how china treats fucking china people. Go to china speak with the same privelege here in America and get you ass cained to death or have your family imprisoned or killed. Chinas cultural views and fucked up conditions can’t even hold a fucking match stick to the priveleges here in America. Dear you speak against your own goverment if they pissed on your mother, less you want your fathers nuts cut, you dog. I’m sure your most likely on American soil talking your shit, you low Dog.
She is a very beautiful young lady. I don’t see that her mother made a mistake. Children are not mistakes; when we treat life as if it’s disposable, you see behavior like this.
I’m rather disgusted by the comments that I’ve read here. Really, it turns my stomach.
Same racism as I saw with the Japanese.
By far the most lucid comment here.
My 1 1/2 cents
I think sometimes it is difficult for Chinese people to show tolerance and charity where it is due. From my perspective they seem to have a lot of social pressure. In this case there is talk about ’shame’ and that this person should remain invisible. There are a few folks who excuse her with more or less empathy or good intentions, but very few with admiration or that are really egging her on to ‘go for it grrl’. Don’t forget, though, that she got this far. There must have been support too!!
To the narrow-minded, ignorant and misinformed:
1. Her mother probably had an affair with a black man because she was unable to feel the maggot sized member Chinese men call a penis.
2. She looks better than most Chinese women.
3. Internationally, black people are held in a higher regard than most Chinese people.
So stop hating, get off your computer and do something productive that benefits not only your own people and country but the rest of the planet as well.
Those comments are unbelievable racist and ignorant. Even though I knew most <> are racist towards <> people I am still shocked at reading this.
What this all boils down to is FEAR OF THE UNKNOWN, in China there arent multicultural schools like in other countrys, this breeds ignorance and fear, where Lou would have gone to school, she would have made friends as all children do, through sheer innocence these chinese children whom have gotten to know Lou as a real person will not have this blind fear of her, she is known to them as simply another person but with a different color of skin, what the chinese need to do but probabily will never is see this fear for what it is and change things in there country to except others with open arms instead of breeding this continuing cycle of fear and ignorance.
As they say it wont happen over night but it will happen…….
Blacks held in higher regard internationally? Really? Which civilized countries are you talking about?
It certainly can’t be any country in Africa. Generations of genoicide, raping of women as a tool of war, billions of dollars donated by other countries only to see people in charge take care of themselves, etc etc etc.
Asia, the only country that looks down on the Chinese is Japan, but we all know their incentives for that one.
Americas, roughly 70% of all convicts in the US are blacks and 70% of all black males ages 21-27 have been or are currently in jail. I haven’t even touched the tip of the iceberg here.
The worst stereotypes of China are its inferior products and manners, but the Chinese sure have a shit load of positive stereotypes as well. I can only think of one when it comes to blacks.
It seems like maybe when you were typing in http://www.chinasmack.com, you meant to be typing http://www.stormfront.org. Maybe you were saying something to someone when you were typing the address? That happens to me sometimes, where I’ll be talking to someone but trying to write something else and I end up typing what I say.
I’m really curious as to where you got those statistics from. Judging from the smell emanating from them, I’d have to guess your ass. The majority of crimes in the US is commited by whites. While a higher number of blacks as a percentage of their general population is incarcerated, the vast majority of violent crimes are commited by the white majority.
Regarding your comments about Africa, I really suggest you educate yourself on African history.
That’s wrong too.
http://www.ojp.usdoj.gov/bjs/pub/pdf/p05.pdf
There are a lot of reasons why, including class, family and other considerations – but black Americans do commit the most crimes out of any race. Not 70% of the crimes, but they are much more highly represented in jails than white Americans.
Or they could simply have been subjected to racial profiling, real or subconciously, and much more frequently targeted for stop and search, as in “yeah, it was a Black Guy with Gun (BGG)”. Then booked for minor infractions when if it was a seemingly well mannered white or geeky asian dude, they would’ve more often than not be left off with a caution. And once da big o’system gets ya, ya’re up da shit creek without a friggin paddle.
Lazy ass statistics are a dime a dozen, gimmee the juicy and meaty long stories behind it.
These are Department of Justice statistics about jailhouse populations, not misdemeanors. Yes, there are problems with racial profiling (and other things i noted), but it’s ridiculous to dismiss statistics just as much as it’s ridiculous to live by them.
Ahhh…very goody you got da point there E. Wanna join me for some hoomp-a-ding-ding?
Really? Did blacks drop bombs on Hiroshima and Nagasaki?
Did blacks murder 6,000,000 Jews in Germany?
Did blacks declare war on Vietnam?
The men in jail in China — are they black?
Bernie Madoff, the man who ripped off 5,000 people — is he black?
The Enron scandal, the Adelphia scandal, the worldwide financial scandals that drain thousands of people of their money — are they black?
The tongs who bring opium from China to sell in the United States — are they black?
The same tongs who force many Chinse women into prostitution in the United States — are they black?
Just thought I’d give you a few things to think about, you stupid muthafucka’
One more thing: It is not hard to learn how to cook Chinese food. If I ever get the money I need, there will be NO Chinese restaurant in my neighborhood.
YOU ARE A CELEBRITY!!!
WOW.
CELEBRITY COMMENT WAS TO ELAINE.
SHE IS CELEBRITY YO.
I KNOW, I’M ALSO CELIBATE.
Accept the facts. These were released by the government roughly about 5-10 years ago. Even Obama has come out and spoke about the problems that African Americans in the US represent. (NAACP speech)
Are you saying that Africa hasn’t committed these atrocities to each other?
Educate myself? At the very least, I can read and understand what others are writing. Even the shit that comes out of my ass has a higher intelligence than you.
Do I hate blacks? No. Do I have black friends? Yes, but I’m certainly quite aware of the social problems that the US has and African Americans play a big part of it.
A! i like you a lot!
I agree with “J” and I am a black woman(currently living somewhere in Asia) from an African country ! I will also admit , I hold Asian people in higher regard than my “own” people…
which country in africa, nigeria well in that case stop lying you not un african
1. if you are black your pathetic
2. holding chinese people higher than your own race is just self hate
3. i feel sorry for you, and
4. have a nice day =) haha
The first race was the black race and the last race will be the black race… just so all of you know. So let everyone talk now because we are and will always be whats good.
I have to enlight some of you Chinese, I am a soul brotha # 1, that’s obvious not my name, but call me that..sound good? I was in a small furniture store- P.S. Discount Furniture, Pasadena, Ca, to be exact. There was a nice older Chinese lady and her hubby working there.I found something interesting, and it wasn’t the furniture,either.I browsed for about an hour or so while this lady watched me, staring. Her hubby went on a long delivery, I overheard her say “Go to Ontario”. After he split I asked her about a foot locker she had. She walked over and said, ” you like?”. My c%$k swelled up instantly.She was shaking.I looked to see if there was at least a little gap,..nada. I put my hand up her thigh all the way to her “pewsie”, thats how she said it, cute…,anyways. I told her I want to play a game.She said huh?. I said it’s my favorite…WHFTB.I showed her what it stands for.She now has quite a bit of daylight between the arches. I wonder if hubby notices the roomier enviorment. I picture him saying, ” What the Fook?!” True story..I have a few more..
even when they talk about you and call you dirty, and dont complement you for you mind but hate you because your color is consider ugly.
Im not going to bow to people that feel Im nothing why should you.but its your business
I agree with bsma, the so-called “African”women living in Asia. like her, I hold Asian people in higher regard also. Especailly for their straight forward violence against the envoronmental, sexism and blazoned discrimination against women, being ticky, and of course with regards to doing laundry.
P.S.: The whole world knows China cheated right in front of our faces during Beijing 2008 Olympic Games.
“Asia, the only country that looks down on the Chinese is Japan, but we all know their incentives for that one.”
Ehh…no, that would be a no, no, no. HK and Taiwan are looking down on ‘mainlanders’…but as you consider them part of China, what about Korea or Singapore…any developed nation look down on Chinese. This can’t possibly be news to you?
Koreans look down on any and every other single race/ethnicity.
Singapore isn’t worth mentioning in my honest opinion. They’re the equivalent of the Chinese when it comes to morale and ethical issues. However, because of their stricter laws, they appear more civilized. Go spend a year in Singapore and you’ll know that it’s about the same.
HK, thinks they’re better and manner wise they’re a bit better. But that also depends on who you compare HK to. If it’s Beijing, no. A hick filled village, yes. This is the biggest problem with China right now. There are too many uneducated hicks running around ruining the image of the country.
Taiwan . . . not really better. Southern Taiwan where the “true Taiwanese” are located are little better than village hicks form the main land. They just pretend they’re better, but they’re shit too. Look at the last President of Taiwan.
I will agree with you on this issue. Blacks as whole are not held in high esteem and I do not feel that that is because of their skin color but because of the violent attitude many black people can have. I do not see Chinese people as a whole as violent or dangerous as black people. All races can have pros and cons.
“the violent attitude many black people can have”
What in the hell are you talking about?!?! You do not see Chinese people as a whole as violent or dangerous as black people???!!! These comments belong up there with the ignorant Chinese comments about the young girl. Obviously you have not seen a gang of guys beat one man to the point of death. Where has this happened? In China. Perhaps you haven’t heard about the husbands that rape their wives in rural villages. Or about the countless other crimes that go unreported daily in this country. Open your mouth when you speak, not your ass. You are grossly misinformed and for lack of a better word, a complete MORON. I am a proud African American and I will NEVER be ashamed of my people no matter what the socalled “statistics” say. Do blacks commit crimes? Yes. But for a group of people that are STILL not treated equally, what can you expect? Is it an excuse? No. But, again, I will say you need to know what you are talking about before you open your mouth.
The wise has spoken tell them , the most important thing is we should not argue with this people too much because they can’t see the truth and chinese or asians in general are best people in force pretendence and and hiding evil did the real luciferic way, they can’t accept that most evils done in this country is evil but only can show example of africa personaly i agree in most societies we have good and bad people, but the truth is somebdy never seen a lot of incedence happening in china ,chinese people killing each other only for small reason like( you hit somebody on sideway walk ) most of them tend to carry small knifes which known as chinese guns, most people in here are misinformed and don’t know a shit about chinese life and societies ,most of rape cases between uncles and nephews cousins and brother and sister those are good quality for them, what happen in here are more worse than even what happen among black societies but just because they hate black ,they legaglize the sin in their societies and wash from black people,ask them who made those statics? is he/she black? the answer is no so what you expect them to say? accept that they commit crimes never, you know fun enough egyptians pharaos are presented in white or arab faces is it true? if they can change that great history you expect them to say they commit crime? most people in here are just like football fans just want to comment without knowledge
peace en love man
in that case your right so we all fall in same category but it is just one race with high number , not bad
Sorry I must disagree with you. The problem is that Blacks are not as violent w/attitudes as most people believe. The whites/kinds are for more violent and have very self center attitudes it all about me .Case in point look at the majority of the World Wars.
Perhaps, before you eat your hat Mr. Willy, you should live in China, Canada, or any foreign country where there is a large Chinatown. You should mingle a while to see how fiercely secretive Chinese people in fact live. That is why you do not hear much about crime. It keeps the authorities, both Chinese and non-Chinese out of the loop. I assure you it will both silence and surprise you. Chinese gangs go by the Asian motto of “Honor-Loyalty-Respect,’’ are only second in brutality of violence to that of Russian gangs, who have been as of late replaced by the viciousness of the Mexican cartel gangs. How do I know this you may ask? My relative’s occupation involves monitoring international gang intelligence and trends in all forms of trafficking.
It is not only Black people who can be violent, all races can be violent. Besides those Ukrainian and Croatian gangs are also operating under the radar. Speaking of Blacks and violence, just the other day, some guy in the Croatia senselessly killed his own mother because she walked in on him masturbating. Yes, I am quite sure this is violence too. Truly, just copy and paste web address below into your Google search box or any URL:
http://www.dreamindemon.com/…/man-kills-mother-after-she-catches-him-masturbating/
or about Ukrainian gang violence
http://www.splcenter.org/intel/intelreport/article.jsp?aid=944
or
http://www.reuters.com/article/idUSTRE5326FP20090403
Your so right, Blacks are violent.
To hell with your comment you fucker of racist.all this balck doing great around the world are droping from heaven? are they not from Africa.How about your morthan day genocide.All you need in Africa is there resources and exchanges it for Arms.color is color!the worst you commited in the world is morthan any black.you can cover up your bad deed and opens others.Beside you peoples means nothing to Africa and expect and just mother fucker racist.
what has blacks done to help blacks in africa? most of what africa has now is from charity.
What do you clueless ignorant know of what you attempt to speak of? Half the wealth of this world came directly out of Africa
alot stuggle here what can they do, what can we do. the ones that can help do help. get the facts right
[comment hidden for too many negative votes -- click to view]
please display this research, to promote our cause. Because when in the sauna, this is not so…they cannot find yours
didn’t mean to vote positive! you suck hello friends!
J, please inform yourself. Where are you getting these statistics from? That more blacks than whites are not given parole or are given stricter sentences for the same crime seems to skew these statistics. I did a report on crimes in America, from thefts, to rapes, to murder. More blacks are convicted of smaller crimes but are given longer sentences versus their white counterparts. Blacks are being marginalized more in the US, which again plays to the racist tendencies of a bigoted country. If only the rest of the world would learn from America’s mistakes and not repeat it.
Again, please inform yourself before throwing random stats and proclaiming them as fact.
J says: Americas, roughly 70% of all convicts in the US are blacks and 70% of all black males ages 21-27 have been or are currently in jail. I haven’t even touched the tip of the iceberg here.
In reality, ” About 10.4% of all black males in the United States between the ages of 25 and 29 were sentenced and in prison, compared to 2.4% of Hispanic males and 1.3% of white males.”
A disproportionate amount of black males are in jail, but it’s no where NEAR what you’re saying. In fact, the majority of prisoners are white.
In fact, the majority of black prisoners (and prisoners in general) are in jail for drug related non-violent crimes.
I sincerely Hope that Helps, Retard.
Hey you,
what are you talking about?
Forgotten the students who had been killed in China?
Mao? AND ALL THE STUFF? ComE on… Don’t think China is an exemple…. Don’t!
the students killed at tiannamen square is nothing compared to the number of chinese delivery guys killed deliverying chinese food to blacks in the project neighborhoods of usa.
Give me a break. I am black (Caribbean) and I was born and raised in Canada. I come from a large (middle class) family and we have all done well for ourselves – no criminals in my family.
Positives – We are smart, resilient -no matter the adversity, and creative, etc. In terms of genetics, we are strong with great skin – no plastic surgery needed.
In terms of crime, it depends on the stats you take. Yes, there is neighbourhood black on black crime, but on a global scale – no. The people responsible for the economic down fall of the entire world were not black. Also, these people have not been charged for their crimes.
Africa is a mess due to colonization. The colonizers raped the land and the people many times over. When they left, the Africans modelled the same behaviour. Finally, Africans are not making guns and weapons being used. Get your facts straight, bud!
P.S. Canada is the best country in the world to live.
Canada the best country in the world??? I don’t know about that.
No offense, but:
3) Black people are the lowest of the low in social ranking internationally. This is largely due to the political and economical situation in Africa.
One of the reason that this story cause so much reaction on the Chinese forum, is that Chinese people believe in “marrying upward”. Which is why if the father have been a white guy, this story would not cause so much reaction. But the fact that her mom cheat with a black man, it makes Chinese wonder: why?
I have no opinion on this story, I just want to clear out your confusion.
Ya, I’m all clear now.
@Ming
I agree with you. The low social, economic, and cultural level of blacks in Africa contribute to people having a low opinion of blacks. Until the African/black political and business elite clean up their act, their people will always be looked down upon.
This situation of looking down on Chinese by whites also existed in the US. Chinese were considered weak, dirty, and uncivilized.
It was only after Chairman Mao established the PRC did the white world realized that the Chinese now knew how to fight and could not be bullied any more.
(This same thing applied to the Jews. They were once consider weak and dirty and despised by everyone. But once the Jews established the state of Israel and fought several wars and defeated the Arabs, the world realized the Jews now knew how to fight and would not be bullied anymore.)
In the US, it was against the law for a Chinese to marry a white person until 1967.
When Bruce Lee married a white woman, many whites made disparaging remarks about a white woman marrying a Chinese, just like the comments directed at this young black girl’s mother.
Irony of ironies, the US had several Chinese communities in the South where Chinese men married black women because of the restriction on Chinese women entering the US. Today, there are many “black Chinese” descendants from those relationships.
http://www.oah.org/pubs/magazine/asianamerican/vivian-wong.html
Tom Bradley, the five-times elected mayor of Los Angeles, is of black Chinese ancestry.
http://books.google.com/books?id=JBiB_Mzsa2kC&pg=RA1-PA134&lpg=RA1-PA134&dq=black+chinese+texas&source=bl&ots=RNQqT92qbJ&sig=-_tiljgUoqOr0Fw8QIpaO1zpOe0&hl=en&ei=EcqfStuoHYiO6AOA3pzwCw&sa=X&oi=book_result&ct=result&resnum=8#v=onepage&q=&f=false
It’s amusing and pathetic to read the ranting of the ignorant and the stupid. This is the drawback of democracy and the internet.
I’m glad you didn’t participate in this stupid discussion.
but do you know what african or black think of you by calling them low, your an idiot your high right in which case just tell how higher your?
ATLEAST FRED YOU TALK WITH POINTS BUT NOT MING
Yes. I do believe that in hierarchical Asian countries, the whole world is ranked from top to bottom. No one wants to associate with ranking below one’s own.
This is a drawback for many Asian countries. It promotes outrageous racism. Also, it exacerbates superiority and inferiority complexes. That is how oppression works.
So, coutries that rank higher are constantly chased and there is a great feeling of inferiority towards them. Hence, the better looking white woman lead Asian women to perform ridiculous surgery on there eyes so they are not slanted. Absolutely ridiculous. Now, for the coutries that rank below, people feel self-righteousness and a superiority that they are better.
Their system is their own private hell. Misguided superiority and exaggerated self-hatred tug them at both ends. I hope the rest of the world isn’t headed in this direction.
Next, there has been a discussion of black people in prisons. Think about it. People who have to deal with this type of racism for no reason other than skin color, how would you be if unfairly treated this way.
The best situation would be to take the racists of the world and isolate them on another planet. Then they could drive each other insane with their hatred. After all, people like that deserve each other. They could rank themselves there.
your making it worst actually. Why do you have to look at blacks in a bad light all the fucking time!
One in africa is a poor cuntry but the ones that go to school are usually a students and become doctors in the states or something else. We have CEOS and we have other major achievement but because the rest of the world refuses to see this so does china. chinese has poverty also right! so dont post this on our race alone cuz it really stupid
It is manifestly untrue that internationally, blacks are held in higher regard than Chinese. I cannot think of anything more false, in fact. How can anyone think that ? It seems that someone who has never set his foot outside China is allowing the Hollywood media to shape his opinions.
Chinese: law abiding, intelligent, self reliant, hard working.
Black: Put “not” in front of each of the above.
Chinese – please add – child sex trade, drug lords, female genocide, and human rights violators
ChinaSmack should just take comments like these off the site, not “hide” them and allow a simple click to reveal its contents.
You are soooo… right MJ. She does look better than most Chinese women. Some black man with money needs to go and get here and take her away from all the haters over in China. I bet she will make beautiful babies of her own. I also believe that her mother just wanted to experience what it would be like to be with a black man. She didn’t want to leave her husband.
Btw, in the Caribeans there are lots of people with Chinese surnames, being descended from inter-marriages between black women and Chinese men, like Edouard Wah or Naomi Campbell. Then there is Jean Ping, the Chairperson of the Commission of the African Union.
With China’s increasing role in Africa, there is likely going to be even more mixed race children. So welcome to the gene pool, especially if they are as hot as Lou Jing. Or Fabulocious! as they say in Jamaica.
You mean to tell me her despicable mother didn’t even buy her an parasol after she was born? Shameless.
How is she despicable? She made a mistake. There are MANY, and I repeat MANY cheating husbands who aren’t reproached as much, and that’s totally hypocritical! Also, a parasol is an umbrella, so I don’t know what you are trying to say about the daughter.
I really don’t understand why Chinese always talk bad about the Japanese, Korean and vice-versa because it seems to me that they have the same mindset, to keep the race pure and don’t breed any mutts… to hell with that racist shit! racist people are the lowest piece of shit! Biracial children are just as beautiful!
Eh…OK lets generalize all 1.3 billions+ Chinese shall we. Man! Christ on a stick, some of the comments here are as bad as those above about Lou Jing. Lighten up peeps! Spread da LOOOVE!
Or better yet, let me spread me looove all over ya…
Come back to bed baby and spread your love all over my anus…..
*sniggers* Quel q’un douche est muy sensitivo. Was fuer ein Arschloch! LOL!
Tiger Woods is black / Thai. Kimora Lee Simmons is black / Japanese and was modeled for Chanel in Paris. Tyson, the male model, is black / Chinese.
Since when was it “common knowledge” that Asians and blacks make “gross” babies?
I was at a conference overseas and some (embarrassing) fellow Chinese kept standing up to condemn American “hegemony.” Had no idea what the h*ll she was talking about.
Americans have long embraced difference. It’s the Chinese who insist that everyone is the same! One race, one country, one Party…
I hope these comments are from crazies on the fringes of society, and that the average mainlander is not this ignorant and racist.
Tiger Woods is black?!??!?!
NO…he’s a rainbow because the sun came out after his mummy and daddy made lots of rain…
I think he is like a quarter black or something.
I read comments above from Tianya and netease and I feel ashamed of my fellow Chinese people. Not to make excuses for them but even for America, arguably the most diverse and open country in the world has had lots of problems with racial conflict/discrimination, and China is much more monolithic when it come to race with ~90% Han and probably 99% Asian population. It’s easier to discriminate when no one knows anyone from a different race.
and btw she is smoking hot!
“Ohmygod! A black person on Chinese TV! I can’t accept this modern society! Help me!”
Just kidding. Those comments crack me up.
Wikipedia: Woods is equal parts Chinese, Thai, and African American. But whatever.
w76 — you’re totally right! How many Chinese descent from concubines, or mistresses that cadres keep in “second houses”? People are naive if they think everyone on TV comes from some pure background.
he’s 1/3 thai, 1/3 chinese and 1/3 black? i mean, i can see how mathematically that could happen, but it strikes me as a little unlikely.
LoL Kellen
Since a child always comes from two biological parents, one can only be portioned into traditional categories of race with denominators in the powers of two.
what Panic! meant is that tiger woods is equal percentage (25%) of thai, chinese, and black, but that’s not all he is, evidently he is also 1/8 native american and 1/8 dutch.
There is a pretty interesting article on his race defined in a multiracial america.
From Salon.com
http://www.salon.com/april97/tiger970430.html
Yeah I agree with you, every country has problems with race, but I find it worse in China regarding black people. I saw these wall hooks for sale in the supermarket a few years ago with little pictures on them – cartoon versions of black people with hugely frizzed out hair, massively puffed out lips, dazed looks in their eyes and bones through their noses! As many problems as the west has with racism, that would never fly in a normal supermarket over there.
Duda, chill man, lighten up. It’s call comics, caricatures, exagerated imageries whatever. Life would be pretty boring if you take the pc crap too far without considering the context.
I mean seriously, imagine no manhua/manga, Disney, Marvel, DC or Dilbert. Life just ain’t the same.
I like your laissez-faire attitude Gaad, you seem like a fun guy. You’re pretty off base to compare the picture I described to manga, disney and dilbert though.
Ahhhhh!!! I sooo like you too Tic. Let’s all hold hands and sing Kumbaya and have a lovefest now shall we?
Yeah, Tiger Woods mother is Thai and his father is black African-American.
what are you smoking?
America created institution of racism. Maybe you should read some history at how USA treated asians and chinese
America hegemony is disgusting
Racism was around long before the United States of America was founded.
Perhaps you should read a history book, dumbass.
“America created institution of rascism” – that has to be the stupidest comment I’ve ever read anywhere in my whole life. You’re not Eric Wong / Smickmo by any chance are you?
Ok, Joke-time is over. I’ve seen comments comparing people to animals (some of which I’ve written) — and THAT was the stupidest comment you’ve read anywhere in your WHOLE LIFE? Based on the fact that you are possibly a Teacher, you yourself take prize for stupidest comment. We all know that America was the first to industrialize the institution of racism. This gross indecency in Chinese thought, I speculate, would not exist at this level without Western mass media’s teaching prowess. There were racialist institutions, that’s a given — but the filth of China is of such a gross and cookie-cutter magnitude as to suggest an offshoot of the American “phenomenon”.
“We all know that America was the first to industrialize the institution of racism.”
Firstly, who is “we?” You, and who else? The US WAS NOT the first society of people to enslave others. You are saying that the US, a nation not even 250 years old created the “institution of racism?”
The institution of slavery is the beginning of the “racist institution” you speak of. Racism, then, can be traced all the way back to 1760 BC. In the Code of Hammurabi, slavery was clearly part of the Babylonian civilization. Slavery also traces back to the Sumer, ancient Egypt, ancient Greece and ancient Rome.
Where are you getting your historical information from?
Racism is older than America.
Btw can’t ChinaSmack translate some of the supporting comments on the Oriental Angels website too for a more balanced view. Tata and cheerio matey.
Oh boohoo, look at us the poor Chinese who have everyone being racist against us. And when we get the chance, what do we do? Be just as racist, if not worse. Goddamnit their level of hypocrisy goes beyond childishly excusable sometimes.
Oh Mon! Looksy like I need to spread some of me precious Chinese love all over you too eh?
Yeah because Chinese people are to blame for the Holocaust. Chinese people are to blame for genocide of Native Americans. Chinese people are to blame for lynchings, Jim Crow, church burnings. Chinese people are to blame for the annexation of Texas and California. Chinese people are the ones occupying 100% of the world’s best land and 30% of the world’s total land mass.
Get a clue idiot.
Chinese people are to blame for the Cultural Revolution, The Great Leap Forward, The Tianmen Square massacre of 1989, etc.
U forgot to blame Chinese people for yourself too.
Blame Chinese people for myself?
What does that mean?
I’m not Chinese.
Are u sure? Are u very, very, very sure? Go do a DNA test fer u’ll find it most illuminating.
glad to see u recognise that not even 1% of china is not a dump
agreed
So, Lou Jing’s mother bore her lover’s child, she isn’t the first woman to do that and she won’t be the last.. on the other hand, she should be praised for choosing life and raising such a beautiful biracial daughter in a homogenous society while having to face being stigmatized. I can’t even begin to imagine all the racial slurs, disaproving looks and evil gossip she and Lou Jing must have faced on a daily basis. I commend this brave and proud woman. She did a mighty fine job of raising her child to become a beautiful, young woman despite all the hardships they must have faced and will continue to face through out their life.
Hear, hear. How many generations before we get common thinking like this here?
Heavy metal is the law.
Lou Jing’s skin-colour is approved. Black is metal.
Lou Jing’s music is not approved. It is pink and ugly.
Read about crabcore and China at http://chinosophy.blogg.se/
Welcome to Hell, every one.
The LACK of racism in this country is amazing. I might just live here for the rest of my life because I absolutely despise the completely racist Western country I originate from.
If you don’t get the sarcasm in this post, turn off your computer, go to the bookstore/library, read a f’ing book and learn something.
Most black guys are incapable of maintaining long term relationships. I’ve seen it happen a million times. They stay with a woman until she’s pregnant and then there on to the next one.
Most people like you suck a lot of dick and like to give rim jobs to down and out people who haven’t washed their asses for decades.
Been married for 20 years. Have 4 brothers all in similar long term situations. That’s 5 out of 5. Your statistics are pulled right out of one of your homeless lover’s asses
Woah! Easy there friend, angry black man stereotype to the fore. Let’s not feed the buggers any more than their puny little diencephalon can handle.
I like you Gaad! You and I have much in common.
Let’s hang out and suck each other’s dicks while we light firecrackers and talk about how much we love China.
So what about the fact that 60% of African Americans grow up in single parent families? Or perhaps the statistics of drop outs/under age pregnancy that happens in the US with African Americans?
The truth of it is that I don’t hate blacks. I have very close black friends. However, we must face reality and deal with these social problems that the African American culture has.
Not saying that other ethnic groups in the US and around the world don’t have their own set of problems. It’s just different sorts of social issues from those of blacks.
The fact is the young black males of which you speak have not run off to get some other girl pregnant. They are in prison. In the united states they privatized the prison system. Those running the prisons can not make a profit unless they have criminals to put in their jails. Corruption and jailing of blacks is rampant. If someone makes a profit based on how many black asses end up in jail guess what happens next…..
http://www.cnn.com/2009/CRIME/02/23/pennsylvania.corrupt.judges/
If you are really into statistics check out the justice department figures which show black people routinely get jail time for minor crimes that whites wouldn’t even be arrested for.
ROFL.
Because having black friends suddenly makes you immune to racism.
/end sarcasm.
Get a clue. It’s not “African American culture” dipwad, it’s the effect of generations of economic, social and political dis-enfrancisement and INSTITUTIONALISED RACISM.
I will give your ignorant arse a moment to look those terms up.
Again, here you are mouthing off without backing it up. Please unfriend your black friends because you are clearly learning nothing from that which informs this discussion.
I’m with black guy below. INFORM YOURSELF and STOP LOOKING LIKE AN ASS.
“I have very close black friends” sounds like an explanation given by an undercover racist.
look at obama’s father and tell me he isn’t black. perhaps you’re the one who can’t tell one nappy dicked brother from the one you’re blowing with all the hiv infected monkeys you’ve eaten.
YOu’ve seen it happen a million times huh? you must be very old and experienced. Where do you even think up things like that. “most black guys” is it really that easy to generalize? Has a white man never left a pregnant woman to fend for herself? you associate “black” with a poor sense of responsibility. In fact, it’s a personal decision. Are you saying these men leave their partners because they are black? Does being black make you inherently likely to run away from your child? I wonder what gene determines that.
My exwife is black thats why I know so much about it. Steve McNair is a good example of this, only his girlfriend wouldn’t put up with it.
There’s a good reason, I assume, that your black ex-wife is your EX. I wouldn’t want to live with a spouse that views my race as irresponsible, unintelligent and all-around bad.
In reality, you know nothing about the black condition, in the States or elsewhere.
She is black, yah right. Do not use the – I have black friends argument – to justify your argument. Own it.
P.S. For the millions you have witnessed not staying with their women, the black men in my family married their women and then had children. No divorces.
My ex-biatch’s name iz joe and me best homeboy’s name iz joe too. And you’re a tool too, tool.
So fucking PC in west about black. But regarding Chinese, they show no hesitation about their racism. Fucking Cowards.
Come see me. Seriously, I have no racism in me, but I also won’t accept your shitty attitude.
And I’ll just show you my love.
I want Gaad! to blow a WAD of his “love” in my tight, yellow butthole.
I want to feel all two inches of his boner in my Chinese ass!!
JIA YOU!!
you are a true 白癡
Oh please, people only show PC in public. Look on the net at youtube comments, SomethingAwful forum, and 4chan. Same type and intensity of racist comments.
This is the internet, there’s no real life negative consequence when one makes a racist remark so it’s a free-for-all. Heck read through this and other Chinasmack comment sections, half of the comments here discussing racism in China are racist.
your examples suck. youtube commenters are known for being bottom of the barrel knuckle-dragging mouth-breathers. 4chan racism is a joke. and as a goon, i know somethingaweful does not tolerate racism. i’ve seen people perma-banned for it too many times.
I will think the criticism arises due to the fault of her mother. If her mother will to marry a black when she is still single, I believe the issue on the color of her kids will not be subjected to any ugly discrimination. The moral story of the whole article is that Asian society as a whole, is not willing to change to open society as compared to the West. It has nothing to do with Chinese as rascists.
There are TONS of kids here born from EXTRA marital affairs. There are tons of extra marital affairs here, so what is the issue? Oh, that it was made obvious by her abnormally well toned skin and perfectly proportioned body?
These KDS fags can rot in hell… making ridiculous amounts of totally ignorant remarks about a situation that they don’t understand. Most of them are trying like hell to cultivate their first pube and they dare to castigate this woman and her daughter? Fuck them.
New Mission of the week, I am gonna find me a married Chinese bird and fuck her pockets empty.
Wooo! Can I please come along? Please? Please? Pretty please, with lots of cherries on top?
And I, will pay. First treats on me gentlemen.
Uggghhh!!! Some hommie simply don’t know the meaning of irony….
That’s right bro I think it’s time I went back to Africa and organise a political party that’ll kick all the chinese men out and leave their woment there to inter breed.
lou jing’s black father is just the dirtiest scumbag.
@ Hell — Oh please. I’m Chinese and grew up in the U.S. Except for a few schoolyard taunts, there was NO racism against me or my family. Not at school, not at finding a job, not at making friends, not at dating — nothing. My dad’s American company even paid for him to improve his English with a tutor.
Actually, I think racism is worse against blacks than Asians in America. We’re just known as being good cooks and being good at math! Asians generally fare pretty well in the U.S.
Talk to mainland Chinese though, and they are FULL of racist thoughts. Laowai are like this. Blacks are like that. Mixed-race are like this. So judgmental. Just like you.
The only “racism” I experienced was when I met a group of Chinese students at a U.S. college and they yelled at me for bringing a blonde friend to the table. They said “no foreigners can sit with us!”
So true. Mainland Chinese people are hella racist towards black people. It not they racist cuz they are just mean people, but they just don’t know any better (i.e stupid) They think they are either poor, stupid or a thug.
all of thats because you’re a girl.
you should look at US media more closely or better yet read US history at how chinese were treated
yes and look at how white americans treat black people and study the 400 years of slavery that african americans went through.
both black and chinese people have been victim to racism so why turn on black people instead of uniting against racism?!!!
“…400 years of slavery that african americans went through.”
Wait, are you saying that slavery in America is 400 years old because America isn’t even 300 years old yet.
yeah cuz racism is done by white peeps against white peeps huh shit4brains?
Simply because the Chinese were treated poorly by US Americas does NOT give the Chinese a free pass to be racist against ANYONE. Are you justifying hatred on the grounds of being hated?
Yeah, everybody has a chip on their shoulders, so what’s new?
Yeah, and our Chinese penises are only 2-inches long so of course our Chinese men have chips on the shoulders!!
just because 1 illegitimate black child is not well treated does not give ANYONE the right to say Chinese people are racist. look at the way blacks treat ethnics before trying to be the judge. a chinese kid going to a black school will not be treated 1/100th as well as she is treated. at least your’re not seeing black eyes or broken bones.
School yard taunts don’t count as racism? Seems like you’ve been living with a paper bag on your head. Americans try to keep a visage of PC but it is very much there.
Mainland chinese can be racist, so can Koreans and Japanese. My black friends have told me they felt most discrimminated in Korea and how many countries have you come across that have a “no foreigners” sign allowed legally outside their stores? Japan being one of them. Comments about Laowai this, blacks that are not “racist” they’re called racial prejudice. People like that are are either ignorant or hicks who were brought up without knowing better. Racism is when you think your race is superior to another. And actually there is a conception among chinese that mixed race people are usually more intelligent…The more mixed the smarter. judgemental? yes, racism? Sometimes.
Imagine if the Chinese father accepted his biracial daughter openly. Would Chinese people be even more racist? I would admire his courage and love. But what he did was logical. Poor Lou Jing. Shame on the mother. I hope her biological father trips on a gun while robbing a gas station and gets a bullet in the gonads.
I’m bookmarking this page. Whenever I think there is hope that I can understand Chinese society, and the differences aren’t insanely vast, I will reread the Chinese comments.
Why do the differences look so vast? The Chinese racist and bigoted comments look pretty much the same as Euro/American racist bigoted comments: fear of the presumed sexual power of black men, worrying about the purity of the race, viewing black people as uncivilized or criminal… I can’t see anything here that shows a uniquely Chinese version of racism. Anyone from a European culture who thinks this is incomprehensible and alien has (a) a poor grasp of history, (b) a short memory, and (c) the good fortune not to have seen many comments on sites like youtube.
yes i agree this is not the same type of racism as the white Americans against black and hispanic people. However, this is still a different type of racism and the ignorance of these racists must be addressed. As knowledgable people we must educate those niave racists about other cultures so that these views maybe changed.
I am a black europeon of Chinese, Caribbean and south american decent. I admit there is rascism all around the world in different forms and extremities. I am lucky enough to live in a city where there are many cultures and where the goovernment do a lot to limit racism and educated the ignorant.
Please people! GO OUT AND LEARN ABOUT DIFFERENT CULTURES!
You guys are all crazy. These people aren’t racist (there’s no racism in China), they just hate black people is all.
…and a follow up for the slow: that was sarcastic.
yeahh its in blood and tea!
No, it’s in da love juice. Want me to show you mine? You’ll like it very muchy, I promise.
Gaad! is so funny and clever. His comments give me a happiness in my trousers.
Come blow your love juice in my gay, Chinese mouth but make sure you have enough for my boyfriends too!
And what that suppose to me (hate black people)you fuckingchineseheadshit.
uk- grow up you peace of crap
Chinese people are indeed racist but currently, at least, nothing beats the number of white anti-miscegenation websites on the web. I took some time to browse through that circle of blogs and MAN, do they hate other races (esp. blacks and Hispanics).
how can you compare this?
I’m white and I have a ton of Spanish friends.
I don’t know a ton of black people but most of the ones I’ve met were cool.
that’s coz we r superior and rich and we invented the internet
if u dont like it dikwad , y dont u leave lol
i live and do my business in china and i have a chines girl friend that works with me one day we had a lorry full of load in my warehouse and my workers were busy off loading the goods the driver of the lorry asked my girl girl y they chines girl always like to stay with a black man.do u knw the ans? she reply to him if u had a daught would u let stay with a stupid chines man that will not last 30 seconds in bed or an inteligent coloured men that will enlighten her on the way of life and at the end of the day makes her fill like a realy woman.pls chines wake up from ur slumber.
Your argument would have the slightest amount of meaning if it were readable. Not only is there no punctuation, your sentences are incoherent. That leads me to think that your account is entirely fictional because it is not possible for such an uneducated buffoon such as yourself to have “my factory”. pls johnson wake up from your mental coma and remove yourself from the human gene pool.
Dave Chapelle was smart he married a filipina.
I love the Dave Chapelle sketch where he’s a blind KKK member.
Oh wow I never knew that until now lol
lawl,
china is the most racist place i have ever been to.
that this article is passed of as NEWS, is a fkn disgrace.
keep pretending this is shocking guys.. its just normal in china.
Call me once you see a lynching in China. Until then, stop whining.
Why does it have to be a lynching?
How about someone being shot with a gun?
Did Mao Zedong say something about “political power comes from the barrell of a gun” ?
Racist? The chinese didn’t import blacks to the new world like herd animals. They didn’t break the front teeth of black slaves to force feed them liquid and keep them from suicide. The chinese didn’t exterminate the native americans in both North and South America, and practically the aboriginals in Aussie. The chinese didn’t rape, pilfer and burn the non-western world in their quest for domination and natural resources. Having built the railroads and mined for minerals, the western and aussie countries then expelled the chinese and signed chinese specific exclusion laws. If the chinese are racist, then I guess it takes one to know one.
The mother is a tramp period. What else do you call women who has an affair. The father is a lowlife scumbag. I wouldn’t have any beef with the daughter, her being born is not her fault. However, it is my beef when she uses her blackness to get notoriety. If you’re going to play that game, then don’t be surprised if you get burnt from the other side of the coin.
And all this PC black love in the western world is just the current hollywood/media fad flavor of the day. Of course, hollywood and the media runs a massive trade in racism and ignorance.
While I have no lamb chops with your first paragraph, but following on from your second paragraph, do you expect the girl to hide her face under a hoodie all her life? And how exactly do you know she is using her “blackness to get notoriety”, oh my sweetie pie?
Is the media-entertainment industry not a valid occupational choice for a black-Chinese gal or does blackness automatically equates notoriety in your mind? Dude you need to unzip your pants more often and live a little. Now go love a sista. I for one welcome her addition to the Great Chinese gene pool, oh yes…
Ah yes, respecting black people — just a fad!
Sorry to interrupt your self-righteousness, but just because China didn’t enslave black people doesn’t mean Chinese people can’t be racist. The US didn’t force thirteen year old girls into marriages for money and bind their feet until the bones cracked and bled, but does that mean only Chinese people are misogynist?
(Hint: the answer is no.)
Also, I wonder how she is “using her blackness to get notoriety”? By going on TV and revealing that she is half black?
And just because you’re an obnoxious whiteboy parasitizing China and abusing white privilege it means you can lecture more progressive people on race?
No.
LMAO.
“More progressive?”
Did you even *read* the comments directed at that girl? Ring me up once China actually progresses, k?
And just because your a self-righteous nationalist tool devoid of empathy and racial intelligence (read: not racist), does it mean you can lecture “obnoxious whiteboys parasitizing (LOL, I love how you used creative verbage on that one!) China and abusing white privilege lecturing your (noticeably less) progressive people on race?
By god, no.
Heh?! Non comprendre was der Kerl parler la. Can somebody 翻译 per favore und mucho obligato.
probably her ceing black revealed it on the television. i mean call me a rocket scientist and i didnt even watch the (s)ho
so what? that was at least a century ago. blacks cut their women’s genitals and stitch them up to control them. black men also rape 4 year olds to cure themselves from hiv and this is happening daily in modern africa. as you’re going on about chinese people, another black trash is out to commit another crime. blacks are racist, the reason why blacks were slaves to begin with were because they were sold to whites by blacks. she is “using her blackness” to gain unearned fame, money and sympathy.
Just who has the time for you redheaded Orangutan? Why not go back into your cave.
Dude, seriously. The slaves thing (as well as most of your other examples) was CENTURIES ago. We’re talking the here and now, present day.
lol. slavery in China was officialy banned first in 70′ens. together with ceremonial canibalism and human sacrifice.
Well, that sounds like progress to me.
yeah, because fads always last for 45 years. the rest of what you wrote is just more of the ever present, fenqing banality: strawmen to distract the reader from the original topic.
“Your shoe is untied.”
“Yeah?! WELL YOU’RE UGLY!”
Chinese kept slaves for centuries, just because (most of them) weren’t black doesn’t mean that China never had a tradition of slavery.
I love the fenqing who have suddenly become so interested in American slavery…I’m sure the African-American community appreciates your “leeching” of their story of struggle in order to prove that Chinese aren’t racist…
Point being, you’re an ignorant asshole.
You really have no clue how many married women are fucking someone else do you? LOADS!!! And the only difference is that this woman was getting some black rod… she was likely occasionally doing her husband (as Chinese couples tend to do I’m told) and she decided to have the kid.
Kudos to her…. how would she know what color the childs skin is.
She won the lottery. That child is gorgeous.
“Racist? The chinese didn’t import blacks to the new world like herd animals.”
No, but they did import them to China. In large numbers
http://www.sino-platonic.org/abstracts/spp122_chinese_africans.html
as for genocide, take a look at Tibet. 17% of all Tibetans killed in the last 48 years. That’s pretty impressive killin right on your own border.
But, hey you can prove anything with the facts.
Which the delightfully racist elements in China are happy to ignore. At least in the west we acknowledge racism as wrong, not hold it up as some sort of virtue.
Yeah, not to mention that blacks in America are probably better off than blacks in Africa.
Africa is in the state that it is in now because of slavery. If slavery had never happened, the continent of Africa would be more developed and many of the countries would be some of the richest in the world. But then again, many people don’t know this because they can’t think for themselves and instead accept whatever they are taught in school. Africa WAS the richest continent in the world til many of the kings and rulers were taken and families were separated. Since then, all of those countries have been playing “catch up”
Yeah! Other people made us this way!
“Africa is in the state that it is in now because of slavery.”
Evidence?
Can you site some sources?
makes u wonder y as “The number 1 power” they allowed their poor little hynies to be seprated , enslaved etc, doesnt it? o wait did some1 say low IQ?
Dear Fike2308,
Africans in Africa are not necessary better off or worse off than their American cousins. All races have good & bad points ditto all the racist comments about Lou Jing.
Unfortunately C’est La Vie.
Regards.
Bam Bam
PS I am an African Black
I wouldn’t be too self guilty about having certain stereotypes. Specifically on blacks, where do we get the stereotypes from? Hollywood and the western media, the same ones who now propagate the black love fad and evil chinese/asian stereotype.
And these “enlightened” above commenters spew the same, if not worse, hate, racism and stereotypes based on a few internet comments.
Something about a kettle name calling the teapot comes to mind.
Who taped you in front of a television and forced you to watch Hollywood movies anyway? Many of us who grew up in the US managed to grow up much less racist than these commenters, despite the fact that we’re WAY, WAY more exposed to the so-called “Western media” and Hollywood.
As for it being hypocritical for Westerners to say anything….this is PEOPLE talking to PEOPLE. I am not “The West”. I never enslaved a black person. You are not “China”. You never bound anyone’s feet (I assume). Whether or not it’s hypocritical for me (or some other commenter) to say these netizens are racist, well, you have no idea. You don’t know any of us personally. Of course, there are frequently racist comments against Chinese people made on this site so I assume some of the commenters here ARE being obviously hypocritical. But you see my point, perhaps.
In conclusion, lame excuses.
Well said ChinaGeeks, 100% agree.
Also, it’s pot calling the kettle. Not kettle calling the teapot.
Teapots are known to be all sorts of colors. Much like our world.
“Specifically on blacks, where do we get the stereotypes from? ”
My response would be that most stereotypes are based on reality.
Look at Apu in The Simpsons (one of my favorite characters).
It’s funny because where I’m from (L.A.) pretty much every 7-11 is run by people from India!
Also, the stereotype that whites can’t dance and asians can’t drive are based on reality.
How does this TV show work? Is it like American Idol, where people vote up their favorites? Because if that’s the case, it looks like she’s ranked 7th, with 1.3 million positive votes and 103 thousand negative votes.
So if this is one of those voting shows, you know, to their credit a lot of people are voting her in spite of her color. That should be mentioned.
Whaaat?! 1.3 millions positive votes and 103 THOUSANDS NEGATIVE VOTES?! There should be absolutely no negative votes whatsoever, dammit! Dang, bugger me silly and rip me a new one, us chinkies are like sooo totally racist, nooo? What does a sista have to do here to catch a break.
I think a lot of people are voting for her just because she is pretty, if you listen to her sing, she is not all that great actually.
http://ent.joy.cn/video/711709.htm
Loujing sings at the competition.
Chinese are the most racist bunch living on this planet, only care white skin, white babies, they’re no different than blacks themselves, bunch of farmers the Chinese are!!!
Dude, isn’t the sun a bit too bright for you? Surely, you must miss your hole under that rock of yours very much.
I miss the loose hole between your ass-cheeks gaad!
Now stop flaming these laowai and come flame my yellow balls!
I don’t think anyone should worry about this, a great deal of mainland Chinese people just aren’t used to this kind of multiculturism. Most of these comments probably come from people who have never even talked to a black person before.
I’d do her but I’d keep one eye on my wallet.
I could do YOU but I’ll keep BOTH my eyes closed with tiger balm on my upper lip. Better yet, give you a paper bag to cover your skanky Pusan face.
Gaad!: I’m flattered but the only man I’d ever go homo for is famous Korean singer Rain.
Giggles! You think I’m a guy? Man, I need to get your Pusan puss acquainted with me jinky-kinky collection of strap ons. Betcha u won’t feel the same about da ladies after that, or much of anything else for that matter.
All those guys, and they are certainly mostly guys, making those comments will be lucky to ever be with a girl as attractive as she is.
Fixed your post:
All those guys, and they are certainly mostly guys, making those comments will be lucky to ever be with a girl
True… you fixed it well.
Chinese are just angry their little dicks couldn’t keep a woman from going off and cheating with a black guy.
Wow! Somebody seems very familiar with Chinese men’s genitalia.
Wow, answering racism with racism. that’s really likely to work. good job. You must be really proud of your penis. Why else would you poke fun at others?
lou jing’s mother was deceived into having a relationship with her black father. i bet you if she is given another chance, she wouldn’t want anything to do with the irresponsible black trash.
@Gaaad!
China’s first Foreign Minister, Eugene Chen, was a mixed Chinese and black (from Trinidad).
He was Sun Yat-sen personal adviser and private secretary, a position he held until Sun Yat-sen’s death in 1925.
http://politicalbiographies.suite101.com/article.cfm/return_to_the_middle_kingdom
Time Magazine, in its Dec. 11, 1933 issue, noted “the new Fukien Government has as its ‘brains’ that amazing man of South Chinese politics, Eugene Chen.”
http://www.time.com/time/magazine/article/0,9171,746478-3,00.html
Eugene Chen’s grave stone in Ba Bao Shan
(Mountain of Eight Treasures) Revolutionary Martyr Cemetery in Beijing.
http://yuantsungchen.com/new_page_6.htm
Whites are very quick to label Chinese racists when it comes to blacks yet China is far down the ladder as being an anti-black “racist” country. I believe that honor belongs to Poland, Russia, and the Ukraine.
Yes, there are Chinese who have anti-black sentiments. So what? In Africa, there are blacks with anti-Chinese sentiments. No need to discuss the anti-every(race) views in the “civilized” countries – the US, the UK, Europe, etc. Matter of fact, xenophobia is the coin of the realm.
Unless there is a higher quality of humans in the world, racism (xenophobia) will continue to exist. Until then, people just have to suck it in and fight back!
Thx for the links, much appreciated. A fascinating and mesmerising history.
Excusing your racism by citing others as racist is amazing but sadly expected from such dimwits.
As always they want it both ways. The victim chip on the shoulder complex with the west but the superior complex with others.
Is there even a racial dscrimination law in China? If there is you know it will be toothless.
!
Nope, no racial discrimination law in China (HK excepted) that I can think of. Everybody is expected to stand up for themselves so that they can stand on their own and be proud of that fact (apart from some affirmative action privileges and financial aid for “recognised” economically under-developed minorities that is). Everybody is expected to be tough as nails and if you fail, too bad, that’s the market economy for you.
Don’t try to talk about “standing up yourself” and being “tough as nails” because that’s horseshit and you know it, I know it, and so does everyone else here. I’d like to see you stand up to a mob who are filled with loathing for you because of your skin color. And market economy? I wonder what the Uighurs in Xinjiang would say to that when they see job advertisements that say “只要汉族人。”
Eh…sombody obviously missed hitting the sarcasm tree when he was just a wee apple falling off his daddy’s tree, non? Here, have some more cha. You’re choking on all ya righteous indignation and going green in da face.
Besides, are you going to let a sign put you off?
What can I say? Trends in comments tend to lead the reader astray. Besides, given the apparent surplus of bulldozing fenqing, it’s easy to see where mistakes may be made.
Well, ain’t some hommie a quick draw with da lable and name calling when it comes to disagreeable comments. Git personal is da name of da game, non?
“Da healthcare reform iz EVIL! EVIL it iz I tell y’all!”
I find that people who are full of righteous indignootions usually have a corky up an orifice somewhere, whether physically or mentally.
She’s gorgeous.
Hot Chinese girl with junk in the trunk.
ooh right.. cuz chinese girls are flat and black girls are really curvy right?? how clever
There is no truth to that? or are you just blind…
I am not making judgements either way on appearance but…
BTW…
1) there are tons of black ‘races’…
2) Chinese is a NATIONALITY… not a race
Yes, Chinese girls are usually flat and not as curvy as black women….or western women.
Tits and asses are not appreciated in the middle kingdom.
Reminds me of ya motha…
What is wrong with everyone? I think she is a beautiful mix and she must have such an interesting heritage.
Her parents are just normal people. How can you judge them without knowing anything about them? Maybe the mother’s husband was a complete arsehole.
if a guy go after a married woman, get her pregnant and then run off without paying child support, is it normal? if the woman’s husband run off after seeing his wife give birth to another man’s child, then he is an ass?
What a topic, huh?
China is racist, like all countries. The fact that the population is overwhelmingly of one race (90% Han last time I checked) doesn’t help this fact. One big problem I have with Chinese racism is that it is considered completely acceptable by most of society. No one is going to speak up when someone makes a racist comment. For example I celebrated Spring Festival with my old host family and the dad made a joke that Obama will turn his milk black (or something like that), the family was so surprised that I, a white Anmerican, would consider that wrong. Or consider the story of a black English friend of mine who taught at a public school in Hunan. One of her students drew a picture of her as a monkey playing basketball. Naturally upset she went to the administration. What did they do? The principal laughed at the picture and refused to punish the student. While all of this is going on the government makes out China to be a place that loves people of all colors. That’s not what they’re saying on the streets.
I think a lot of Chinese consider the West (whatever that is) as racist as them, no doubt due to our horribly racist hsitory. But the fact is we take racist actions very seriously and I’m fairly certain China would too if the country wasn’t so damn homogeneous.
couldn’t agree more, what’s lacking is any form of intelligent dialogue about race, if this forum is an example there is a long way to go. i think there is more to it than just being homogeneous, education, and worldliness are still stumbling blocks for China.
lol the story with the little kid is fucked up but also kind of funny…
Homogeneous=Inbred
I agree with VeerLeft’s equation.
Yeeeee!!! What a cute lovely couple you too make!
Why are you following me around?
It seems like every time I make a post you have to hurl some random insult at me.
Very weird.
Cause you soooo angry dat you a soooo cutie! Me likesy precious!!!
The sad thing is that it is not seen to be morally wrong at all.
Next time they bleat about anti Chinese(government) bias this should be thrown back in their faces.
It reminds me of nothing more than bullies who can act big but whine like children when it comes back their way.
USA takes asian racist actions seriously?
I forgot you are white and you seem to know whats going on even though you are not asian
Well, that there destroyed my naieve notion that China is merely backwards due to being a more homogenous culture. I don’t think there is any excuse for this!
BTW, I’m in LOVE! Marry me???
Very beautiful girl. What a shame that she has to bear the brunt of such vitriol from ignorant morons.
Seriously, I was very surprised at how degrading some of the comments were. Even if her mother chose to have sex with a black man, why should they give a damn? Her mother is an adult, she made her choice and she has accepted responsibility for her actions. Who you fuck/date/marry is no one else’s business.
While I agree with all of your points – the moment you thrust yourself into the spotlight (ie. appear on national TV, or media, or whatever) you need to be ready for any and all criticisms that may come your way.
While it’s none of anyone’s business, she chose to make it everyone’s business. You can’t have fame and privacy, publicity and no criticism. They go hand-in-hand, and to think otherwise is ignorant.
That being said, I hope this blows over and, maybe…who knows…opens up some people’s eyes to the issues around racism in China, maybe for the better. Sometimes it takes people who bridge gaps by being multiracial even though they’re seen as a single race, to help build these bridges. (Asian Obamette maybe? haha..)
You are definitely right, the whole thing just feels unfair though…eh, I guess life’s not fair sometimes. :-D
While you make a point, Rick, there’s a big difference between the lack of privacy that accompanies being a public figure and a slew of racially driven criticisms.
Case in point, it’s one thing to make fun of Obama because he has big, funny ears that stick out. It’s quite another to scream “ni–” and “kill him!” at a Sarah Palin rally. Both are inexcusable and should be addressed immediately rather than throwing up your hands and saying, “well, that’s life!”
Are you serious? Know your audience. Everyone seems pretty much in agreement that racism is rampant in China. There should be absolutely no surprise that people are posting racist comments on forums and such as a result of her coming out. Again, *it would be ignorant had they not expected it*.
I never excused it. I simply said it would be ignorant for them to have not expected this backlash. In fact, I think it will end up being very good for her – career wise. If nobody said shit, she’d just be another one of a million.
right. i hope she is not like britney spears..
The problem is she is living on china’s resources and her black trash daddy isn’t working for it. When chinese people are using whites/black resources, it is everybody’s business but when it is a black, it’s nobody’s business? Yes, her mother is an adult, but she was deceived, had the man she conceived the child with been chinese, he will get 2 choices, either go to prison or pay child support. It is incredible how patronizing people get. “Very beautiful girl”, please. She is an illegitimate product of deception.
living on china’s resources…hum? You Chinese Chimps are deadly parasites all over the world….China Towns with it’s hugh importation of every thing fake and potentially lethal! From fake medications to fake cars, drugs and vice. It’s no good having you chimps around…nice idea it will be 1.4 billion less stress on the environment.
You have no idea how many Chinese university students in the US have been caught working off campus at Chinese restaurants. I worked in the International Students office at my Uni…out of 90 students, 10 were sent home. Those were the ones caught. And you know they weren’t paying taxes. So, before you go talking about how someone is living off of a nation…stop and think a little, you self-serving, ignorant, racist fuck.
I’m sorry to say, that by your own words you revel that you are the one who is actually an “ILLEGITIMATE PRODUCT OF DECEPTION”,
I guess, you’d ask, how so. Well, you seem to have a good grasp of Engligh language, which tells me that you must have been writting from some other place, other than China, some English speaking country.
By this, I wonder what your vast interactions with people from other places had thought you. What quality do you have the share with others, that is a result of your family upbringing, or threrfore, should we conclude by your letters, that you have notting of value to offer towards the harmoney of humankind.
Think before you leap!
I saw that show, and the TV presenter had the girl in tears, cos she kept asking about her absent father, where he was from and why he ran away. Just by coincidence (not), there was another Chinese-African kid on a the same show a few days later, and again they were playing up his blackness (he was doing Michael Jackson imitations). This kid’s African father was not openly refered to, but I was waiting for the presenters to start milking his story for all it was worth too.
I agree with the Chinese commenters on some areas here. This was similar to the outrage whites had when they saw a mixed black/white couple in the 1950’s in the U.S. Gradually they relaxed there standards now you have tens of thousands of bastards born to white women eveyr year when their black boyfriend runs away. Often the grandparents end of raising them but this social experiment never works. They still end up dropping out of school or end up in prison. 90% of black Children are born without a father married to the mother. Not to mention the violence in their community.This is in the gene code, look at Hati, any country in Africa, parts of major American cities, etc… you only find destruction, violence, and poverty.
It’s amusing how many people from Mississippi and China share the same views, yet are raised a world away. I don’t know which of these you are more likely to be – neither have a reputation for grammar/spelling or tolerance.
Have you been to Ha(i)ti? Any parts of Africa? In fact, people I’ve met in Tanzania happen to be amongst the least violent or aggressive I’ve met, anywhere.
Rick the Prick- How did you know I was from Mississippi?Interesting how you don’t mind sterotyping Southern whites or Chinese but god forbid someone speak the truth about your precious black people. Hope you can stop teaching English for a second to read this post you loser. Go find a real job. You all show your lack of education and itellectual horsepower with your reply. I talk about statistics…you all start with …well I know this guy or such and such. You clearly are brain dead and don’t understand anything about population distribution. On average, Chinese are are shorter than westerners…no there not, Yao Ming is 7″6. You do have one point, East African’s are less violent than West Africans. By the way, can you find one city in the world with a black majority that is not a violent , desperate, hell hole? Didn’t think so. Ever check the FBI crime stats in the U.S.? Ever think for yourself? Go back to your fantasy now…class will be starting..
“On average, Chinese are are shorter than westerners…no there not, Yao Ming is 7″6.” – ChinaJim
Um, do you know what the word AVERAGE means?!?!
Yao Ming is NOT your average Chinese person!
Based on my experiences in China, Western people, on average, are taller than Chinese people.
Yao Ming is an exception to the rule, not the rule itself.
I hate mindless insults like:
Go find a real job.
Get a life!
Your momma!
Etc.
U seem very good at it.
Can you show me where I have used any of those insults?
Also, why are you stalking me? It’s like you’re obsessed with me.
you two are cute.LOL.very funny.haha.been reading your comments.lol.
GAaaaahahahahaha.
1. I’m not a teacher. In fact, there’s a very small likelihood you are nearly as successful as I am, speaking on averages.
2. I didn’t say all people from Mississippi or China behave like that, but “many” in terms of how they are perceived, do, hence the ‘joke’. I’ve not been to Mississippi, nor do I know anyone from there, so I can’t seriously claim to know shit about them.
3. You claim I am the one who is “lacking education”, lets see:
a. “itellectual horsepower” (int)
b. “no there not, Yao Ming is 7″6″ (they’re) + (7′6″)
c. “East African’s are less violent than West Africans” (Africans), + You don’t know shit about Africa, moron, Somalia & Sudan? It’s not separated east/west=violent/nonviolent. Stop talking about shit you know absolutely nothing about.
d. “Can you find one city in the world with a black majority that is not a violent, desperate, hell hole?” Accra. Wait, you wont know where that is; it’s in Ghana. Look it up. Wait.. Ghana, Ghana is a country in West Africa which borders the ivory coast (go figure).
Rick the Prick-
Thanks for correcting my grammer Mr. Succesful. Let me guess, your CEO of an trading company? haha
Let me know when you actually sell something.
I drive a BWM 7. Now go get your scooter.
By focusing on typo’s you deflect the real arguments.
By saying W.Africans are more violent than E.Africans does not mean E.African’s are not volent. My God dude, you have no critical thinking skills at all.
I reccomend you study some basic Greek Logic.
Face it dude, you live in a fantasy world. Did you notice I argue against your statements, where as because I do not share your viewpoint I am somehow “un-educated”.
Your the programmed one, not me. Go back to your Matrix Pod.
Regarding Ghana, Ya, great place. Ghana has a high HIV infection rate,extreme violence to women and most of the population lives on a dollar a day.
You called me uneducated, Jim. Then you went on to rant…a rant riddled with many language mistakes – that’s the irony, Jim, which you exhibit very clearly for all to see.
I’m not even going to address the rest of your ridiculousness, it’s not worth my time.
ChinaJim is an a#$h%le.
1.Ghana has the about the lowest HIVr rate in Africa.
2. No woman is discriminated against here (except Jim’s mother who came here and was running a brothel serviced by Chinese girls after seizing their passports.
3. West Arica has only the black sheeps of Liberia (now calm) and Sierra Leone (serene).
Jim get a tutor and I hope u regret cheating in your history lessons in grade school. You know?, dont make a comment about something you dont kow shit about. it only makes you look STUPID. If u had kept your mouth close, we’l have thought you wise.
Mmmm, I love the taste of ignorance in the morning. I like it bitter just like my coffee!
ACTUALLY, there are many prosperous African nations, let alone cities. Please educate yourself before commenting on the state of a continent which you know ABSOLUTELY NOTHING ABOUT?
Right then. Feel free to return to your poorly-informed worldview now.
most of these “prosperous african nations” make money by starving their own people from donations from the UN. perhaps you and mugabe make the most ignorant bunch.
ChinaChimp, or Jim, you said, “By the way, can you find one city in the world with a black majority that is not a violent , desperate, hell hole?”
That city is the one that raised you to be this vile sub-human, beguiled by inept perental background.
I waste my time to ask, which black counties have you been to.
Rick, don’t be a douchebag. Stop stereotyping people. You just made a comment about how the Chinese and Mississippians “share the same views” and I take it you mean “racist”. However, that statement in itself is also stereotyping a group of people based on your own ignorant ideas.
If you really want to get back at ChinaJim, who is also a complete moron, then stop assuming ChinaJim = Every Chinese Person or Every Mississippian. That’s bigotry in an article condemning bigotry.
Aaah. The master geneticist as spoken. He’s found the gene for parental absenteism that only manifests itself in black males throughout the world. The may be spread throughout the world but their genes are all the same. what a revelation from a truly enlightned mind. I especially like that statistic. I’ve met countless young black indivduals in my lifetime and the only one who did not have a father had lsot him to the warfront. I guess I was really lucky to always fall in the 90% right? I’m really interested to know where you got that statistic Chinajim. Did you also come up with a name for that gene you discovered?
Here you go A.
I stand corrected…It’s not 90%…it’s only 70% of black children born out of wedlock.
http://www.npr.org/templates/story/story.php?storyId=4865449
The DNA gene code you asked about is as follows: ATCGCGATGTTACGCHIMPATTCGCGAGACGACCGATTAT
Very witty to throw a “chimp” in your pseudo-code.
You’re not worth the time to argue with. Just another ridiculous bigot.
haha- opps, that was a typo. Here is one you won’t figure out.
I meant to type…..ACTGGGCATTAGAATTCGATOMOHASIKCIRAATTCCGGATCG
Genius.
You’re also anti-gay, then, ya?
Out-of-wedlock births are also rising in much of the industrialized world: in Iceland, 66 percent of children are born to unmarried mothers; in Sweden, the share is 55 percent.
http://www.nytimes.com/2009/05/13/health/13mothers.html
Let’s pretend that you are NOT an idiot….(for the sake of argument)
By your logic the genetically submissive yet devious mother cheated on her genetically inferior and under-endowed husband… with the genetically masculine and genetically irresponsible black american…
How should this reflect on the Genetically diverse and physically pleasing child?
Oh wait…. the commenters are GENETICALLY STUPID AND GENETICALLY incapable of empathy. Well thats inbreeding for ya…GENETICALLY speaking.
ChinaJim welcome in Tanzania, stop talking bullshit you not sure of ”HAKUNA MATATA”
Yeeeeh!And everyone knows that China is a marvelous lands with lots of happy beautiful people, national health insurance and pink poneys.
You know Africa so well and I guess you can tell violence is in gene code because you got Ph.D. in Molecular Biology
Wow, I guess most of these farmers have never left the country and don’t know anything besides their own culture.
Ironically cheating seems to be part of this culture – or which Chinese man goes to KTV only for singing? What about all the pink lighted massage parlors? Only for singles? What about the second wife phenomenon?
This debate shows once again the double standards in China.
I don’t think this is a case of double standard. Ask these netizens how they feel about officials with second wives and they’ll give you the same response. Where the double standard might exist is what they do with their own lives as they get older. Young people are often self-righteous. But as they become adults and enter into that corrupt, cynical, dog-eat-dog world, their views begin to change.
It’s called hypocrisy – and it’s not limited to China. Look at all the republicans in the US being busted right now for preaching about family values, yet caught with their mistresses? How about the priest who faked his own kidnapping so he could spend more time with his mistress? This is definitely not a China-only circumstance, it’s a human circumstance that happens everywhere from developed, developing, and undeveloped nations – I’m sure the Korowai cheat sometimes too, the difference is the result is the cheating husband/wife ends up as his/her family’s next meal.
I agree. However…
I think they will NOT give the same response. It will be, “Oh, those officials suck, because they had second wives.” It will not be an attack on their children s or wife’s race.
The problem is not with what people say, but what people do. People say one thing and do another. It is hypocritical and annoying. So many pink houses and a lot cheating exists in China… A place where prostitution is illegal.
Also, I don’t agree with the older example you gave. Having experience in education, I can say a LOT of middle school students in China are sexually active. The parents are clueless. Bad behavior starts young and matures as people get older. Same thing happens to good behavior. No one just grows up and do indecent things because society is that way. They learn these things from an early age and it just matures. That doesn’t mean society can’t influence them. But, at their core people’s identities are composed of nature and nurture.
The self righteous problem doesn’t only affect the young. I noticed that many “adults” are also self righteous as well. Just not many people can back up the righteousness. So we live in a society where these same self righteous adults, create young self righteous children. The circle restarts over and over. But, no body just comes out and faces things directly.
As for this case of cheating, I don’t know if I can say her mother was right or wrong. I simply don’t have enough details AND I don’t care, because it’s none of my business.
So what’s your solution?
Solution: Be the best person you can be, and try your best to obey the rules of your society, or choose to leave your society if its rules don’t agree with yours.
Hello!
Well, I just want to say. She is hot and I would probably tap it. Ok, Definetly…
I think there are a few issues that I haven’t seen addressed. 1. WHY IS IT ANYONE’S F*CKIN BUSINESS WHAT HER MOTHER DID? Anytime a chinese person goes on these shows, they don’t do a back ground check! Now, because she’s black, they MUST make sure her history is justifiable for the Chinese audience. Are we in America? (The oh, lets check the black guy and make sure he is not a gangster mentality, is not wide spread in the U.S., but it happens. F*CK!) At least, in the states someone can sue for this kind of sh!t!!!!!!!
Also, how can people pretend the know the whole story of the affair. Maybe, her husband was a lying sack of crap and she felt lonely. Maybe, the guy she had an affair with didn’t know she was pregnant. It’s all so upsetting to see another case of Chinese unable to mind their own business. But, the big question is…. What does this have to do with this innocent girl? She was not involved in her mother’s affair and at least I respect her mother for taking care of her.
The next problem, I noticed in China is the point the finger philosophy. It happens way too much here. Its not everyone, but its enough to piss me the hell off!!! In China, how many people cheat? All of my friends have been cheated on. Men and Women. To be honest, not all of them were angels. They cheated too. But, when someone that is black, goes on tv…. It’s like, lets hate the monkeys. Truly upsetting…
Don’t look outward, without looking inward.
Yes, I know that there are many Chinese that are not racist. However, I will say that A LOT of mainland Chinese dislike OR are completely ignorant about black people. I know a lot of people that refuse to hire black people. Shenzhen and Guangzhou has some issues like this. Some of them, don’t even check there qualifications. The funny thing is I am good friends with a lot a black people and they get along with Chinese well.
Some Chinese also use the examples of Nigerians near the coastal cities, committing crimes as an excuse to justify their racism. I know for sure that every foreigner cannot do business without a Chinese helping them in some way. So, if someone in China is getting away with illegal activities, im sure they have some guanxi with local Chinese. Especially, when the penalties for drug trafficking is so high. So, you can’t blame all black people for the co-operation of some foreign idiots with local idiots.
Im not surprised to hear about this. I think as China develops even more. A lot of truth will come out. Especially, matters regarding race…
IM VERY GLAD CHINESE PEOPLE ARE TARGETS OF RACISM AND PERSONAL ATTACKS WORLD WIDE….
THE chinese people who travel only hangout with chinese people unlike Japanese korean etc.
The Chinese people who are stuck in China for good, ARE JUST CONFUSED ON LIFE.
PS. That girls body looks HOT
Ah yes. it’s really fair to wish to perpetuate racism on the whole of China because some people in China are racist. that will really help clear the world of all racism.
Are you serious? At my university, that’s common with the Chinese, Japanese and Koreans. They hang out with each other all day and speak their native language, but stutter making basic English conversation, but that’s another topic.
She’s a beautiful girl, her skin colour shouldn’t matter. You Chinese are just petty minded racists, would it be such a problem if her father wasn’t black?
I’ve learned to accept Chinese racism for what it is. In 3 years in Shenyang I’ve heard many appalling comments from Chinese people about other races, but there was almost one underlying similarity: None of them said the comments with hate.
In my experience, those people did not hate, and hate is what makes racism bad. Discrimination isn’t always bad, and is a necessary part of living. There is no way to deny that people are different. Chinese who make racist comments are simply regurgitating opinions that have been formed by living in a single-race society. They have little hate in their hearts for these other races most of the time. The other times, their stereotypes have been reinforced by one or two personal experiences that had been negative and were never offset by positive experiences.
For example, if someone tells you that red=1 and green=2, and all your life you had never seen red nor green, then finally one day you see one instance where red=1, you will be inclined to believe that first of all it is true, and second of all you will make the jump to the conclusion that green must equal 2 as well.
Chinese people that I know that have been exposed to many more personal experiences regarding different races are not racist and do not make such comments. These comments are born from inexperience.
From the dictionary:
racism /ˈreɪsɪzəm/ Show Spelled Pronunciation [rey-siz-uhm]
–noun 1. a belief or doctrine that inherent differences among the various human races determine cultural or individual achievement, usually involving the idea that one’s own race is superior and has the right to rule others.
2. a policy, system of government, etc., based upon or fostering such a doctrine; discrimination.
3. hatred or intolerance of another race or other races.
http://dictionary.reference.com/browse/racism
Racism fosters hatred. In some ways it is a form of hatred, because it implys inferiority. Hatred can also be ignorant. When someone realizes the stupidity of their hatred, they will change. Usually, because they realize how ignorant they were.
I have done somethings im not proud of. But, I cannot make an excuse for them. I have even hated. Illogically and ignorantly. I wasn’t even aware I was hating. So, im glad I took the time to educate myself. Others should too.
I totally agree with you. Acceptance of other customs, races, religions, cultures, etc., comes from a willingness to learn the beliefs of each. Those who cannot accept how others are different from them are destined to be isolated from the rest of humanity for the near future at the very least. Humanity’s strength lies in its resilience and adaptability, and racism directly attacks that strength by assuming that one part of humanity is better than another. This, according to Charles Darwin, is true. It was not, however, based on race, but on adaptability. Those who can adapt, will survive. Those who cannot, will die.
Are you suggesting China should adapt to the world or LouJing should adapt to the racism?
it is so obvious that niggers are inferior. every jiggaboo country is a dirty corrupt dangerous shithole. I have lived and worked in Nigeria and it is the epitomy of evil and niggerism. guns, drugs, HIV, leprosy, TB,…., they are diseased inferior gene stock .
evolution is evolution, they are on a lower rung. one day they will be gone, sure their genes will mix with higher sub species,
when people ask me what working in africa is like, i tell them that we should stop trying to help them until they invent a phone, have them call us.
why is whatever guy taking over my name???
I’d fuck her. Well horny. Bet she has nice perky dark nips.
Laugh at all the stupid racist Chinese blogging like crazy and all actually acting themselves like a bunch of monkey niggers. Fuck off you racist pigs. Chinese people are more like monkeys than black people are. Ooophhhh Ooophhh Ooppphhh just keep spitting on the street you gob-shite slit eyed chinky monkey niggers. The world was better off when China was closed. Now fuck off back into Communism you nasty fucks. You’ve got to be dumb and stupid to allow the Commies to rule you. Black cocks rule weeny yellow tiny Chinky penis anyday.
Well said, if only those racist Chinese pigs (or is it monkeys?) are as open minded as you, the world would be better off.
Congratulations on your black cock, fantastic job, here is your prize:
//\
V \
\ \_
\,’.`-.
|\ `. `.
( \ `. `-. _,.-:\
\ \ `. `-._ __..–’ ,-’;/
\ `. `-. `-..___..—’ _.–’ ,’/
`. `. `-._ __..–’ ,’ /
`. `-_ “–..” _.-’ ,’
`-_ `-.___ __,–’ ,’
`-.__ `—-”"” __.-’
`–..____..–’
.//\
.V \
. \ \_
. \,’.`-.
. |\ `. `.
. ( \ `. `-. _,.-:\
. \ \ `. `-._ __..–’ ,-’;/
. \ `. `-. `-..___..—’ _.–’ ,’/
. `. `. `-._ __..–’ ,’ /
. `. `-_ “–..” _.-’ ,’
. `-_ `-.___ __,–’ ,’
. `-.__ `—-”"” __.-’
. `–..____..–’
Nigger cocks with tumors, AIDS deformities, 2 pounds of shit, genital warts and crawling with crabs.. rules the eight circle of hell, maybe.
Niggers are a bunch of filthy, retarded chimps. I hope more niggers die of AIDS.
WTF are you saying. My god. The number of irrational people these days astonish me. People like you are what hold the world back, no joke.
May your God bless you and keep you.
there is an irony to black cock. it spits fatal disease.
herpes
HIV
chancroid
granuloma inguinale
lymphogranuloma venerium
hepatitis
syphillis
the ultimate demise of most of africa spews from the dirty cock of nigger men. kind of ironic, they are fucking themselves to death. most countries are billions of dollars behind in their antiretroviral contribution promises, i was at the 16th HIV conference in toronto speaking on distribution of antiretrovirals in africa. most of the other aid workers felt the same as me, in that the western world is just standing back wathcing the niggers die and then they will move in and rape the continent, again
da gong ji
The perfect example of the modern Chinese health professional……no wonder medical types in Chinese hospitals are held in such disrepute, on par with black society members and real estate developers. Do something useful. Invade Taiwan. Stick your head in a rice cooker. You are a virus.
i am not chinese, i am a white nigger hating man. proud to be prejudiced. china hospitals and doctors are pathetic, i agree.
so HIV didn’t come from a nigger fucking a monkey because it reminded him of his little sister?
quitting saying bad things about the mother and the daughter. Give a little love to them, shut your mouths,and mind your own business. Okay, don’t be nasty to them. They need help and understanding.
First of all, this girl is beautiful and proves once more that mix race gives the best results.
Her mother and herself must have lived difficult moments in such a mono cultural country…
About chinese racist comments…well not a big deal : don’t expect tolerance and smartness from narrow-minded people who have certainly never seen, never talked to a non-chinese.
It’s always the same story : fear + ignorance + cliché = racism
So…Lou Jing, Keep it up…racists either open your eyes/mind or get lost.
Peace
Fucking Chiggers
so would she have a tiny hole with a tiny muff of soft black hair like a chinese girl or would she have a huge gaping hole with a razor wire bush like a negress.
She’s definitely one of the hottest chinese women I’ve ever seen.
She look better than most ghetto blacks but i don’t think she look any better than a made up blackstreetwalker in most industrialized countries. I won’t pay more than a penny for her.
You come across as a dull but angry yellowish chinky chimpanzee. Why? Because you’ll never get a bronzy toned girl to go out with you? What a shame… blame your centuries of eating paddy field rice on your shrunken genital, even at it’s best it looks like the head of a dead parrot hanging out! Even your own Chinese women would not go out with you Chinky Chimpanzee looking creature. Lou Jing looks much better than anything that would ever come out of your retarded China for the next 10000 years.
black breeze, niggers are black, not bronze, bronze has some value, coal does not.
She’s beautiful. I hope she has the emotional strength to weather this storm.
I read a story once where all the people in the world were approximately the same color of tan because they’d mixed races to the point where there were no discernible races anymore. Wonder how long that would actually take….
Humanity will always find a way to segregate.
Seriously….if we were all white people would segregate on height, eye color, etc.
There is a perfect example of that which already happened in Rwanda. That’s why there was a civil war/genocide.
The Belgiums separated a once-single tribe of people into 2 tribes, Hutu and Tootsis, based only on their skin tone (light/darker) and height. We all know the results.
Belgiums should be Belgians.
Whatever.
Holy Shit is Rick Stupid.
This guy is so brainwashed. Here he is again slagging off “Belgums”. Try getting your history from some other source than a movie dipshit.
The million plus dead in Rwanada had nothing to do with whites. You libs treat Blacks like they are children, they can’t possibly kill each other without whitey causing it. The Hutu’s are a Bantu people and the Tutsui’s are a East African people hence they do look very different and have different mental capabilities. These are ethnic subgroups, people are not all the same just because there skin looks black to you. Once again I will tell you…PICK UP A BOOK ONCE IN A WHILE.
ChinaJink needs to looky at da role of da Frenchies during da Rwandan Genocide more closey me thinks.
PICK UP A BOOK BOOK ONCE IN A WHILE (me likes shouty too)
Isn’t the “go read a book” insult kind of getting old?
Not for Fike it ain’t.
Actually, I don’t go around insulting random people and using tired cliches like “Go read a book”.
It seems like a naive assumption that just because something is in a book it is uncontestably true.
Compare Chinese and Japanese history textbooks concerning WW2 for instance.
Oh, now I get it.
My “Isn’t the “go read a book” insult kind of getting old?” comment offended Gaad! so now he/she has to look up every post I make and hurl some random insult at me.
Well, I hope you get bored of me soon Gaad and start pestering someone else.
No, not that. Saw you other day walking. Your ass very cutesy. Me like riding.
Typically Chinese .. !!
I think she is stunningly beautiful!
She is BEAUTIFUL and at the end of the day fully CHINESE!
you fucking retard.
she is not. her father is what, american?
that makes her half chinese, half american.
shut the fuck up with your fucking nationalist attitude you dumb shit.
Well I accept her as fully Chinese as many more do too seems like and is she not also a Chinese citizen?
Besides, Obama is half white and everybody, including his black brothas and sistas, call him the first black US president. Why’s dat?
My eyes hurt from reading the translated Chinese commentary.
People’s attitudes towards the mother are almost as lamentable. What ‘mistake’ did she make?
if the mom is that great, do you want her? you get the daughter for free.
Wow, see all kinds of emotions stirred up here, so it’s an eye for an eye then, Western hypocrisy and racism meemt their chinese counterparts.
Basicly, Chinese Fenqings say a lot of stupid things, their comment to Lou JING is only a small part. But they are a minority group of the society, and their name in chinese, Shit Youth, says much.
Most of the Chinese are not hateful on races, they are just ignorant on races, as China is what it is, a country of one race. Interestingly, China was not always a country of one race, it become one because of culture assimilation and inter-racial marriges going on thousands of years.
Race centrism is especially interesting here in Shenyang. Shenyang was never really part of China until the Qing Dynasty, but they still claim the entire history as their own here. I recently asked the question whether or not my wife’s grandfather was in fact born in China, and was met with surprise. He was born in Manchuria, which was not part of China, but people here tend to forget that. The Han people tend to forget that their race has continually assimilated other peoples over the centuries, and that Chinese does not mean Han.
I asked some Chinese youths if I would be Chinese if I had a Chinese hukou and passport, and they said, “Of course not.”
I then asked why. They said that I don’t “Look Chinese.” So I asked whether XinJiang Muslims looked “Chinese”. They said no. But then they said that they were still part of China. They said that this was because the Han people were, “Very accepting of the other races allowed to be in China”.
I won’t be surprised when those “Other races” rebel.
Actually, I think you need to looky more closely at the history between Manchuria and Zhong Yuan (中原). It didn’t begin simply because of or at the time of the Qing Manchurian conquest. Da history goes back many a long time ago.
Dey are like when da Roman Empire had black Caesars or da Egyptians had black Pharaohs, but which da sneaky bugger white colonialists conveniently forgeta mention for da lasta hundred years or so.
I once made the mistake of referring to Ghenghis Khan as a Mongolian. Be careful with that one.
Shenyang stand up!
A real, real shame that that disgusting scum whore of a mother is actually still alive. She should be cut into pieces alive.
true that. kill all those who dislike smelly chinks!
spitting on the street and having small dicks rules supreme!
Chinese people are incapable of responsibility on all levels, they lack morals, ethics and a soul. No wonder they don’t fit in when they move abroad and end up living in Chinatowns where they exploit each other in sweatshops or threaten each other into slave labor.
Google chinese morecambe bay
I’m sure you’re just full of morals, ethics and a soul ain’t ya. And if you’re in China, I wonder what you’re doing here?
Part of the “Ugliness” of America is its promiscuity and sexual practices They are well known and despised in the greater part of the world. America has been propagandized to accept much that the rest of the world considers repulsive, much that discourages many religious leaders, much that invites the label,”The New Babylon” for America! Notice, the jews and their ‘race restricted’ breeding practices, the pure blood French Canadians and their racially slanted, linguistically slanted, breeding rites, the Moslem’s sects who prefer interbreeding to racial mixing, Most Asians do not like “hairy monkey’ whites or Negroes for mates, the end result simply does not fit their social norms at home! It is human nature to stick to your own kind, social level, economic and educational background. Familiarity of custom makes for longer term compatibilities! Much of the U.S. male black population, statistically speaking spend time in prison, have multiple female relationships and large disconnected families – Some white guys do this too, but can hide it more easily! A brown woman will likely have a brown child that fits her social milieu, not so a white woman with black child, she is the object of rejection and derision on both sides, black and white! America will have its promiscuity as long as soldiers are needed, and that will be fore a long time, and the Chinese will reject anamalies of race as long as they have population problems to begin with, and much of the world will go on as the Jews have for Centuries, controlling their own, and promiscuous and irresponsible towards goyem, or others! Humanity has races due to this propensity in the first place!
What does America have to do with this?
I’m impressed… I assumed the KKK couldn’t even operate computers let alone type a complete paragraph. Good job Uncle B(funny your name rhymes with cunt in Chinese, coincidence? I think not)!
Black American Dick = 12 inches
Chinky Yellow Dick = 3 inches
Chinese Pussy is tight, black spunk inside Chinky womb.
Yo Mama make beautiful baby.
Conclusion: Chinese need more genetic material from blacks and whites in them, people always say mixed blood are more beautiful/clever. Its well known FACT.
Chinese people are only really 50% evolutionary completed. They need other race to weed out their bad retarded genes.
100% Chinese is obviously not a higher level of homo sapien. The pictures of the girl prove it. Mixed Chinese / Black and she is fucking hot, smart and very very cool.
Her mama knew exactly what she was doing when she wanted some negro juice in her. Clever woman. Respect.
You give respect to a woman for cheating on her husband?
He’s 3 inch yellow dick was clearly too small!
The irony, is that there are more Chinese man marry to African woman then the other way around.
What an irony hu?
NO, NO, NO! He just repects his motha very much, for obvious reasons of course.
How do you know? Did you go and inspect a lot of Chinese dicks here in China? I bet you got a really good and up close look and perhaps sucked a few of them?
“There are blacks and there are niggers. The niggers have got to go.” – Chris Rock
Remember, people in any country, who sit in front of computers all day and night, living in their artificial worlds of digital farms and virtual combat, commenting on the inanity of other places they’ve never been to, and never will, should probably be ignored… I guess that includes me.
For a black person, her singing sucks. So I guess that part is the Chinese in her.
I think Chinese people generally just need to start intermarrying with other races more so the country would start becoming more laid back. For example if you got a Chinese person to have children with a Mexican or some other type of Latino person, you’re gonna get some Filipino kids. Filipinos are the coolest and most laid back people on the earth.
I know of some other Black-Chinese/ Chinese-black people back in the states. The black traits are generally more dominant. The worst that happens with that mixture is that you get these nerdy otaku black people.
The white-chinese mixes are really common. I know a lot of those types of people too. They tend to just look and act more like white people. This world doesn’t need anymore of white people.
I know of a few Chinese-Middle Eastern/Arabic people. Basicaly, what you get with that are more Uighurs/Central ASians. I’ve met quite a few of those krygyzstan, kazakhstan, uzbekistan guys and they all seem pretty cool. Only problem is probably their religion.
If you start mixing Chinese people with Mongolians you get Koreans. If you mix Chinese people with Koreans you get Japanese people. If you mix Chinese people with Japanese you get Taiwanese people….I think you get the picture. The world will just be better with more interbreeding.
Oh yeah, a Chinese person and a Jew = super cheap. I guess you can look at it another way and say that this mixture can give you a person that’s really good with money.
Hhu?! And which pimp made you?
funny! lol.
how about a norwegian with a black father and Afghan mother interbred with a german woman of Indonesian and Aborigine descent?
That gives you a Malaysian.
Pimp war is funny….and right.
I love Fillipinos.
roflmao><
the jews is here its called hong kong
Although I’m not condoning her mother’s action, this racism against blacks just go to show you that so many in China are WHITEWASHED by the stupid white/Jews/Hollywood people to believing that “White is right”.
Wow! A Chinese KKK? Arrrrgh da KKK are spreaaading!
The alliance of Chinese and Jews is bound to happen sooner or later because of their love for money.
We should respect each individual, such taunting are unwarranted.
Fight racism! Fight racism!
wow the commentary on the racist commentaries is … racist. I love the human race :) not.
i hate chinese people
i don’t hate black people
this chick is hotter than 99% of chinese beasts
and yes, at least in the US, black people are much more highly regarded. most people hate chinese and assume (usually correctly) that they don’t speak english or have any desire to assimilate
I hate you. just you, regardless of your race. You have a low standing in my eyes because of the way you judge others.
@ Brzr: If you hate Chinese people so much, stop hanging around websites that are all about Chinese people. Stick to the websites with naked pictures of your sister.
What?!?! Where in the US are you from? Some black ass ghetto neighborhood in the Bronx?
Face it, you hate Chinese because you’re envious of what they have. The average Chinese family VS the average Black family in the US isn’t even close in comparison when it comes to money and family values. Chinese are higher educated where as a black guy even getting into a decent college not based on an athletic scholarship is rare.
The only successful blacks in the US as a whole are musicians and athletes or aka entertainers. That’s all famous/successful blacks are in the US . . . ENTERTAINERS. What a joke. Everytime anyone says anything negative about blacks in America, blacks start playing the race card and gets everyone to back off. Nothing respectable about it at all. Go listen to the Obama NAACP speech and even he says that blacks in the US are a problem.
Assimilate? What have blacks been doing the last hundred years or so? Ebonics, the N word, clothes, style, whigger, etc. Blacks in America are the ones that don’t assimilate and are proud doing it.
You are a moron and have no idea what you’re talking about.
I’m not sure you know what you’re talking about. Concentrated slavery efforts decimated large portions of African civilization and forced black people to spend centuries beneath everyone else. The abolition of slavery did not free black people from the sentiments people held toward slaves. They’d been treated as less-than-human so that slave owners could justify their actions to themselves and to others, and this view has persisted to their children, grandchildren, and so on. The end result is that white people have a vested interest in keeping black people down; the vague notion that they are securing the future for their progeny. This has manifested itself in many ways; including poor funding for areas where black people or other minorities live, racial police profiling that nets more black offenders and harsher sentences doled out to black prisoners, and racist hiring policies in higher paying jobs. If there is a surplus of black entertainers, it is because that is, historically, a job white people are comfortable seeing black people hold.
Fortunately, these tendencies ease a little with every generation, and we see more black people doing well and finding opportunity. You are sad and racist if you think that there is some genetic predisposition that causes black people to want to live in shitty conditions.
This is interesting. Why would any Black person be envious or jealous of someone Chinese. This pathetic tiny mindset just proves how childish and immature many Chinese people are.
First of all let me address, we do assimilate, but there is one thing, you probably don’t know or not educated enough to understand. Do we have to assimilate to the way Whites want? Does that mean the US is the land of Whites and therefore, we have to act and do as they say, otherwise we are the ones that are going against the flow?
America is a multi-cultural, multi-ethnic nation, therefore we have the right to have our own style and culture. Why is that Asians always want to kiss up to Whites, forget their own culture and act like them, try so hard to forget where they come from and try to adopt a banana OC type, “please accept me, I am trying so hard to be like you.” Blacks used to be like that until the 60’s and we got tired of trying to emulate Whites and learned how to embrace our beautiful culture. I think that is the underlying problem with many Whites is that we do often go in an opposite direction or being a rebel if you like. Because for the last 300+ years, we have been acting and assimilating “White America.” Now it is time for us to be Americans, NOT White Americans. There is no such thing!
And it doesn’t matter where a person achieves success or what field as long as they or not breaking the law. Being an entertainer is not a joke or are you jealous that you don’t have the talent of a Kobe Bryant or a Russel Simmons? Or is that you just despise Blacks so much, that when you see a financially successful Blacks, it just burns you?
No one is saying there isn’t a problem in the Black community, but before you run your mouth, understand the reasons, the history as to how that became, how it evolved. So if you don’t understand what Obama said why he said or if you don’t have never lived in a Black community, then you need to take yourself out of the argument.
Asians are strangers to playing the race card, so let’s not go there. I think guys like you are jealous because perhaps some brother got the girl that you wanted and he was very suave and cool, but you just couldn’t compete. Or some brother making more cash or being taller than you, hence, the childish outburst and hostility.
Hmmm…not sure which part of the U.S. you’re from. I also hope my grammar isn’t too difficult for you to understand because according to your assumption, I don’t speak English.
the brotha hit it and then quit it! props! we dont love them ho’s, beechez aint shiet but hoz & trix!!! take that take that take that…
Haha good brzr. I don’t care what other people think, especially if it’s stupid.
You just want to stir hatred in me or whatever in order to make yourself feel good and forget that you are probably stuck in China. Or maybe you are just lonely. I feel for you racists.
If it makes you all feel better murder me?
If someone hurries up and slits that throat of hers before she uses that diseased womb of hers, along with that piece of trash she calls a mother, this will all be over, nice and clean.
the difference between China and the US is simply that the US is better when it comes to multiculturlism as they have more diversity and thus bettern oppurtinitines for people to learn to become less ignorant, about other people.
We’re all people.
I HOPE the Chinese media use this to promote more understanding in order to lessening the stupid ignorance. They better. If they don’t, I’m calling in the alien overlords.
I fucking don’t understand why people do this. It’s so illogical, to live in ignorance. Look at this thread, back and forth ignorance. Chinese defending racism with accusation of racism; the hatred and blaming of Jews, so typical. FUCK I HATE LIFE.
you know why? most black people in China are into drug dealing and illegal forex exchange, and that’s how chinese people stereotype them as, it’s like one bad apple makes all the apple go bad.
True. If you ever get a chance, go to Beijing’s SanLiTuen and you can smell the stench of marijuana from the bar streets. Inside, majority are African or African Americans.
Go to the right place in the U.S. and every Chinese person there would be the worst kind of uneducated, uncooth Chinese person too. If you pick and choose, you see what you want. Also, it’s a bar street, everyone there is there for a drug, whether it’s alcohol, tobacco, or herb, you ignorant hypcritical moron.
US media is so racist free?
have you seen how asians are portrayed in US media?
You know, the fact that somebody else is stupid is no excuse for you being stupid as well.
There’s racism in every single corner of the world. There’s no doubt about it. I seriously doubt that any one country is more racist than the next.
Look at Europe. Eastern European politicans are getting into office preaching hate. UK has problems with Arabs/Pakistanis amongst other things, that’s well documented. The French won’t respect Muslim women wearing veils. (Considering making it illegal.)
Africa . . . don’t really need to mention it. It’s VERY well documented . . .
Americas, the US leads the world as far as tolerance goes, but there’s still shit load of racism that exists. Obama winning Presidency and members of racist groups multiply like crazy. And historically speaking, the US might of been the worst. Wiping out Native Americans and around 1920s had I think 9 million members in the Ku Klux Klan.
S. America is just as bad as Africa.
Asia . . . everyone hates each other, with the Japanese being the most hated by its neighbors.
Racism is everywhere. However, we must realize that most people in the world are good neutral people. They go to work, come home, eat, sleep, shit and that’s their life.
It’s the low life hicks of the world that stand out and embarass the shit out of their homeland.
FUCK HICK ALL AROUND THE WORLD
Using racism to combat racism? Wow… some of these posts are very similar to the ones on the Chinese BBS… Be aware that the internet is full of hateful, bile filled posts.
The true scandal here is that the fucking TV host on a Talent show asks her about her dad, instead of about her career aspirations or such.
Institutionally supported racism.
Wow guy . . . your reading comprehension astounds me. Please go to your local book store and buy yourself a few decent english literature books so that you may enlighten yourself in the ways of the educated.
Has anyone of you entertained the thought that perhaps the TV show asked about her history so that the viewers can understand why she’s “black” and yet “Chinese”.
Trust me on this one, I’ve met some dumb ass Chinese people in China where they’ll only judge on appearances and try as they may, they won’t understand why/how I can speak Chinese/English/Japanese.
It’s quite astounding.
Not you J. Wasn’t meant to be a reply to you. Just hit the wrong highlighted text. Sorry.
Come to the U.S! You will be treated as the amazing beauty that you are!! I am a former fashion model who has worked in New York and LA. Women like you are exotic, and celebrated!
The comments from the select small-minded Chinese are no better than that actions of Adolf Hitler. There IS NO superior race! Our world is only as good as all of God’s creations (and Buddha if you believe). He only creates perfection, and that is personified in Lou Jing!
A black skin is just against Chinas (and its subcultures Japan, Korea & Vietnam) traditional view of female beauty. It has nothing to do with racism. Many chinese girls and women even don’t like sunlight and wear an umbrella against it.
White/pale skin is just the best looking.
Racism is hard to combat in a country where everyone has the same skin color. Most of those people have never met or even seen a black person in real life. Whenever Chinese people, even in the US, say “american” they mean white people and when they talk about black americans, they say “black people”. It’s infuriating and sadly something that will take a while to correct. We can start by not putting only white people on a pedestal.
Having said all that, Lou Jing is soooooooooooooooooo pretty. I wish she would comes to the states. We know how to appreciate that kind of beauty here. :)
Chinasmack: Racism? Sex? Idolatry? I’m there!
Haha sorry, I meant adultery. Too much pagan heavy metal.
Wow, you guys are unbelievably racist. From this I can see that China is truly not ready to join the world.
Who cares what colour ones skin is??? Seriously, you guys are being an embarrassment to China, making all Chinese look as if they’re from the 14th century.
I know this is not true, so please do not act as if it is!!
And another thing, if you really are stuck in the 14th century in your mind, have the intelligence to keep your thoughts to yourself!!
Privately, you can continue to be racist, but publicly, for China’s sake, pretend to be modern!!
if i am a racist for against immigration to china or black men going to china committing adultery and leaving bastard babies then let me fucking be a racist.
ha, even as hundreds of citizens are committing adultery at this very moment, suddenly you’re against adultery…
if it is a black person, right?
good luck trying to get a high reputation for China. Like I said, think it privately but don’t make it obvious to westerns that Chinese people can’t handle globalization!
you don’t goto a foreign country and commit adultery, that’s a ultimate disrespect for the host country, and plus black people don’t have a high reputation in china due to illegal drug dealing and illegal currency exchange. there’s also more than 100,000 illegal blacks in guangzhou you still wonder why chinese discriminate against blacks so bad?
Yippee, come to China but don’t have sex oh and don’t come if you’re from Africa except we’ll come to you and make money off you. But please, don’t buy our guys any beer or wink at them or anything, just hand them money and walk away.
Really respectful.
If there’re a hundred illegal people ANYwhere in China it’s the PAP and Border Patrols’ fault, deal with it!
PAP don’t have any problem rounding up people in Shishou (well in Shishou actually the people rounded up the PAP, but….okay how about Kangding or something) so if there’s – how many – one hundred THOUSAND (??) illegals in GZ, it’s cuz the ZF WANTS them there.
You wanna blame someone, blame the right source.
I agree with SauLaan,
What you don’t know is that organized crime in China is controlled by the locals and a lot of people get benefits. Even, if you want to get involved, YOU MUST GO THROUGH THE LOCALS. So, if someone is committing an illegal crime in China (and making big money), there is a Chinese person involved. I worked in several bars. Although, I wasn’t involved in any illegal engagements. I can say that drug dealing was usually done in a lot of places. Police were given “financial rewards,” every month.
Some Chinese people fail to realize that local governments know and see EVERYTHING! If there are a lot of “illegal blacks in GZ,” they are there for a reason and if they are getting away with drug trafficking, who are they selling it to? CHINESE ARE INVOLVED AS WELL!
I hate it when people use some idiots in GZ, to justify their racism. How about all of the black guys in China that are not drug dealers? I’m sure there are quite a few.
If being an illegal immigrant is a fair reason for being discriminated against, then you’ve just justified all the anti-Chinese comments on here. Those illegal blacks(when was black a nationality) from numerous African countries that reside in Guanzghou might add up to several thousand at most. There are that many illegal Chinese in one city in the US alone. Stick your ignorant head back up your ignorant ass.
You’re not Chinese, so who cares about your opinion?
are you seriously that much of a dick.
You are racist because your eyes are still half closed maybe one day when you guys have the same eye shape(you know like fully opened eyes instead of like someone squinting at he sun)and can see properly then you’ll realise we are all the same oh I forgot you guys have little things.
Welcome to China!
“1. My father is American, not African.”
black people in america = African-American
this dumb bitch just discriminate against her don’t give a shit about her daddy.
But sure lets kick all foreigners out, stop doing business,
and go back behind the Wall, right?
Or…outlaw love?
Time to grow up and join the 21st Century with the rest of enlightened citizens.
sorry man i am grown up, i just don’t buy the multi-cultured crap like rest of you brainwashed folks do.
http://www.dailymail.co.uk/news/article-504354/White-Britons-minority-dozen-towns-30-years.html
aha! The Daily Mail! the well known liberal, intellectual newspapare of choice! Must be true then…
enlightened me more about this love you speak of in your world
Enlightened citizens? Heh, racism is making a comeback in Europe due to non-white immigration; America already has Stormfront and their numbers are growing. We’ll see what happens in eventuality.
The girl is beautiful.
She is beautiful! Can’t sing to save her life but she is quite stunning looking.
Dont know where this fits in, but when wandering through a local craft market in Fuzhou a few years ago, I came upon a copy of Mein Kampf which had been translated into Manadarin. If you want white on black murders, go to St Petersburg.
By the way I support Lou Jing and her mother 100,000%, you guys are despicable to be so stupidly cruel to two fellow citizens. Like YOU’VE never had sex with anyone and couldn’t have gotten pregnant “out of wedlock” [what is this now, Puritan England??? Jesus.]
She’s a beautiful Chinese citizen and I can tell by the way you treat her how you’d treat some so-called “55 minorities” person, probably just as bad. Sigh. Too far to go yet. Please stop embarrassing us in front of the world. You want to be “yesterday,” then yam cha with an older person and grumble about dark-skinned babies while the rest of us emjoy become a superpower with a peaceful rise.
I don’t think a society needs to be Puritan England to look down on adultery and abandonment. I’m not saying the woman and her child doesn’t deserve sympathy – they do. And I’m not saying that it’s fair to blame the girl for her parents’ deeds – it’s not. But this is not simply a case of people being too Puritan, unless you care nothing about family values at all.
Yeah but the only reason anyone cares is because the father was black.
Actually, the reason anyone cares is because she is 1) a celebrity and 2) exotic (so yes, the fact that her father was black does make a difference, but it’s not the only reason).
I doubt it. Adultery is looked down upon by most civilized countries on this planet. But I’ll also say that there’s definitely a double standard in the world.
When men are sluts and go out and FUCK a lot of women, they’re considered “the man” and are respected by other men in society to a certain degree for being able to charm women.
However, when a women does it, she’s a bitch, slut, whore, hoe, especially Asian women where society still has this demand on women here to be pure and free of taint.
There’s definitely other double standards that exist out here as well. Look at Korea where women beating is still more or less socially acceptable or Japan where women just get shit wages and socially acceptable abuse of women is part of society.
Even the US is still sexcist. Women make .70 cents per hour where as the man with the same job would make a dollar.
Let’s face the facts people, this topic is big but not for the right reasons.
Family values?
The world as a whole is losing the battle on this. Look at the typical American family during World War II and look at it now. DISGUSTING . . .
Look at the family value trends happening here in China, especially Beijing and Shanghai where the one offspring per family rule has destroyed some of the young. SPOILED FUCKS who can’t do anything and won’t do anything besides studying.
In my honest opinion, the world needs to bring back good old fashioned ass beatings. Fear and respect are roughly the same thing if you think about it.
“No on is above an ass whooping.”
-Chris Rock
Gotta love Chris Rock (Unless you’re Chinese)!
having a hit at this girl behind the anonymity provided by the internet is something every fu&king person can afford to do. if the chinese want to find out how we regard them in africa then they should listen. just as the N. Koreans see Hilary Clinton to be a funny woman, thats the same way we see the chinese to be funny people but all the same respect them as humans. there are many living here and are well-vexed in fake products and importation of useless stuff into africa. those here are involved in several shady deals and still see themselves to be better than others. but we give them space to breath.
i only blame that idiot of a black man who has brought this insult upon this girl. no wonder he’s from the US.
(\__/)
(=’.'=)
(“)_(“) Down with Racism
You’re the second person that I came across that can do art like this. The other one was a picture of a girl leaning on her hand. Nice.
my teacher once said that literacy doesnt mean education. you may be able to read and write but i dont think you are educated enought to comment on such a delicate issue as this. it is natural for one to defend his/her race but u really need to know that all those stupid news u hear of are just a fraction of africans killing themselves with spoonsorhip money from the western countries. see the kettle call the pot black.
I think at least half of the racist comments come from jealous Chinese girls.
lol you for reals?
go look up the ideal minority, its often written in sociology books.
go look at the majority of people in jail.
look up the stats on who is on welfare.
strong suspect that you are in fact a a black
1.) I was half-joking/half-serious
2.) Ok, there are some black people in jail and on welfare…so what?
3.) How can Chinese people be racist towards blacks while simultaneously adoring the NBA and Kobe Bryant? I don’t understand.
4.) I’m not black, I’m white….who cares?
5.) “Strong suspect that you are in fact” one of the jealous Chinese girls I was joking about.
1) ok
2) Blacks destorys the economy and society, I do not like my tax dollars paying for the baby popping way.
(refer to majority of sociology books, and look up the ideal minority. It states that Asians are the ideal minority in society.)
3)Thats cause the do not have blacks in China causing havoc. Liking them and having them is two different cases.
4)I assume you are either a wigger, or a closet wigger.
5) Sorry ain’t a chick, I am a dude.
I agree that an asian minority in society is probably much better than an asian majority.
Wigger?
Not really….just a white guy from California…more into surf/beach/rock culture.
@ do not want:
“Blacks destroy the economy and society”? Blacks built the American economy and society… without hundreds of years of black people working for free, America would have been nowhere.
Go look up the history of Western subjugation of African, the American slave trade and hundreds of years of prejudice and discrimination. Then have a think about why black people are overrepresented in prison and welfare.
I strongly suspect you have shit for brains.
My parents are Chinese and I can say that she’s hot! ’nuff said.
Wow. So she appears on a TV show where she will be judged on her appearance. And then she doesn’t like it when she is judged on her appearance. Hmmm.
Yeah, okay, she shouldn’t be condemned for her mother’s behaviour, but she surely can’t decide to be judged on her looks and then complain when she is.
Oh and I’m British and not Chinese or of Chinese descent.
she was meant to be judged on her presentation, not racially attacked.
That is just terrible that things like this still exist =O I think China is going through the American phases and they are right now in the 1930-70s. Poor girl who had no decision in what she would be
Good work, CHINASMACK!
Over 200 hits in just a few days.
Nothing will generate traffic better than topics involving Chinese women having sex with foreigners especially if the foreigners are black.
This topic allows every idiot and his mother to make asinine comments regarding blacks – bad; and Chinese women – Chinese women with blacks – very bad.
May I propose a title for your next topic: “Raped Chinese women give birth to Japanese war babies.”
I’m sure this will generate traffic for your site but in inverse proportion to the intelligence of the comments.
“Raped Chinese women give birth to Japanese war babies.”
Can’t wait to read it!
That must be one hell of a long gestation period.
I’m quite surprised by so many Chinese netizens immature view of race. It is instructive how upset so many are about this. Of course extramarital affairs are bad but it’s extremely common in China. It’s only because the father was a foreigner and a black that people seem so upset. What bald racism! The young lady is very beautiful and I hope she doesn’t let the lowlife netizens get her down. If China is too rough on her I hope she will come to the US. We would welcome her.
The only thing I disagree you with, is that the perception of beauty standard is different all over the world. From my understanding, there is a long standing beauty standard in China, and much of the eastern world that lighter skin tone is considered beauty, meanwhile darker skin tone is consider ugly. One of the reason of this is that during imperial time, people with light skin tone are associated as people with office or business jobs. People with dark skin tone are associated as hard labor or farmers who have to work long hours in the Sun. Other asian can back me up on this point.
Therefore, I do not think it is racists for Chinese or other asian to considered dark skin tone as ugly verse light skin tone as beauty. If a man have to have sex with every women of every color just to proof that he is not a racist, then this world will be filled with racists.
PS: I think most of the Chinese netizens were piss that her mother would cheated on her ex-husband with a foreigners, worst of all a black man which in China is considered ugly.
PSS: Even before this story, Chinese perception of black beauty has always been negative. Dark skin tone simplely have never been considered to be a beauty standard. I DARE say that this rule also apply to: south asian, SEA, and even some Arb and latino with dark skin tone. I am not going to lie, racial discrimination is bad. But I dont think dating discrimination is part of racial discrimination. In contrast, plenty of western woman refuse to date asian man. Do we go bitch about it and cry racist?
PSSS: And I do agree with you that she would have a easier life in the US then China due to her skin color.
@ Ming
Point of information.
PS in letters stands for post scriptum, or postscript.
post – prefix – after in time or order
PPS would be post, post scriptum
OMG those girls sing so freaking horribly… JUST MY OPINION but Chinese (actually all tonal languages) are not suitable for singing.
I wonder if this girl can dance though. If she were part Latino, she’d probably sing pretty well. Just listen to some Filipinos sing and you’ll know what I mean.
Seriously, this singing is AWFUL!
The only way this would be American TV (like American Idol) would for people to laugh at and ridicule.
I don’t think most Chinese people can differentiate between what qualifies as good music and what qualifies as shit.
Without a doubt. She is quite beautiful, but can’t sing her way out of a shoe box, but most Chinese or Asians don’t know how to sing or have a clue to what real singing is all about. I am not talking about their traditional music, which they sing quite well, but when they venture into the pop world, like the Japanese(Gawd, awful)the Chinese way of singing pop is over the top unpleasant and annoying is an understatement. Chinese need to overcome their racists, xenophobia fears and work on their singing abilities.
Personally I think tonal languages is great for singing. These girls sings like shit though.
And I’m also sick of all the Chinese bashing on here.
I’ve been here like 20 something years and noone gives a fuck about me. America’s got a personal vendetta against me. Sure, I’m pretty weird and shit but society treats me like some sort of trash. itz total alientation sometimes, I just wanna blow my brains out, except I’m too pussy to go though with it.
I’m sure that someone gives a fuck about you.
You need to throw away all of your emo music!!!
Fike is one angry, unsatisfied being.
Angry and unsatisfied? Why? Because I made a joke about emo music?
Nah, cause u likesy telling peeps what ta do. Usally tis moostly angry und unsatisfied beings qui likesy ta do dat very muchy.
Me thinksy me don’t likesy u anymore. Cutesy ass or no cutsey ass.
Raspberries! Raspberries!
Gaad! Does Google Translate supports the language you are using when you write your comments?
Tried it, to no end, unfortunately. :(
As a side note: According to my Bullshit Detector Device, you are undoubtedly Chinese.
One word (one dream?): Fail
Yipee! Da Grudge wanna join da fun!
What’s a Chinese?
Btw, da Grudge, u a Daily Mail reader? Good fer u.
Sorry, but Chanel Iman is waaaay hotter.
I still can’t over seeing a black chick dressed like a fob.
Just want to say, there are several kinds of people replying to this post.
1. Level headed and rational Chinese
2. Level headed and rational Foreigners
(Some really interesting posts from this group)
3. Racist Chinese
4. Racist Foreigners
(Filed Under Ignore: The usual stupidity)
5. Racist Chinese that pretend to be foreigners that curse Chinese.
6. Racist Foreigners that pretend to be Chinese that curse Foreigners.
(Filed Under Ignore: Only want to make others angry. So, if others are angry and speak without thinking, they can prove a point.)
There are just as much racism in China as in other places in the world. It’s all based on ignorance, period. Most of these people who post these nasty comments probably have never seen a black person, and they form judgement based on what they read in the media, see in the movies, etc etc. The world needs to come together more to eradicate these ignorances.
RE: “Just as much”
Mainland China has significantly more racism than, say, Hong Kong, in my experience – and I’m sure anyone who frequents both will agree.
As some people have mentioned, it’s a very homogenous society, as a result, it’s natural for people to ‘huddle’ with those who look like they do, and persecute the others.
In many cases that I’ve witnessed, Chinese ‘huddle’ mentality goes like this:
Han sees Minority – will single out based on minority.
Han sees Minority and White – will group with minority and single out against White.
Han sees Minority, other Asian, and White – will take the side of other minority, and sometimes against asian & white, or sometimes with other asian against white (depends).
Han sees Minority, White, and Black – will take the side of Whites over Blacks.
That’s the basic “pecking order” from the Chinese perspective’s I’ve witnessed. This is usually a male-only scale.
Han sees Minority, White, and Black – will take the side of Whites over Blacks.
You’re clueless. The smart Chinese person would pit the black against the white. Maybe you’re just hanging around assholes and idiots, since they gravitate to the foreign trash ruining China today.
Foreign trash ruining China today?
LOL!
Shanghai and Hong Kong are two of the best (if not the best) cities in China and they were pretty much built by WESTERNERS.
Oh, and the computer you are using….what role did China play in the invention of the computer (or any modern technology) ??
Wake up and smell reality.
Good points Fike2308, but don’t you think that they were also built on the back of exploitation and slavery?
British ruled HK was essentially a police state, with a curfew enforced during the communist riots. It was only in 1992, five years before the handover, that Patten started democratic reforms which is still a hot topic in HK even now in 2009. I can see the hypocrisy in that, and I’m sure the Chinese can as well. Britain suppresses democracy in HK for almost 150 years, then worrying about their precious subjects, decides to introduce reforms.
As for Shanghai I do agree with you it is perhaps the best Mainland city, in terms of being cosmopolitan and VERY easy to live there for a foreigner.
Also on the computers point agree, first prototype developed in Manchester, England, mass marketed by IBM, first discovery of HTTP by Berners lee, the list could go on…
Nice post.
@ Alan
“Good points Fike2308, but don’t you think that they were also built on the back of exploitation and slavery?”
Probably….I don’t claim to be an expert but what you say sounds reasonable.
Granted, the mother cheating on her husband is bad, I do not condone that, but the child is innocent. I feel so sorry for her, if it was with another chinese/asian man, it wouldn’t be an issue, cuz she would be born with a chinese-like skin tone, even a caucasian male. but because she is dark-skinned, she is the target for insult and racism.
hey I waz just kidding earlier. Now I just find the whole thing funny, the diccusino that is. It’s stupid. This website is stupid. I’m stupid. The internet is pretty stupid. Don’t worry, I will be off soon. My mind is made up. I will still be on the internet but chatting on the internet about random shit–while being put on all sorts of lists–is not my cup of tea.
Really, just read the comments. None of it makes much sense if you read it out loud.
Latest I heard is that is was Obama’s half brother in Shenzhen who’s the Dad.
“Conclusion: Chinese need more genetic material from blacks and whites in them, people always say mixed blood are more beautiful/clever. Its well known FACT.”
Very True.
“Conclusion: Chinese need more genetic material from blacks and whites in them, people always say mixed blood are more beautiful/clever. Its well known FACT.”
WRONG. Half Chinese half white babies have lower IQs, lower wages and lower grades.
http://img36.imageshack.us/img36/1125/gpaandrace.gif
They also are more likely to face depression and other markers of poor health:
http://findarticles.com/p/articles/mi_m0DXK/is_20_20/ai_111529997/
A new study that involved surveying 90,000 adolescent U.S. students showed that those who considered themselves to be of mixed race were more likely than others to suffer from depression, substance abuse, sleep problems, and various aches and pains.
They are also more likely to be obese:
http://scienceblogs.com/gnxp/2008/08/race_mixing_leading_to_obesity.php
It is a well known FACT for Eurasians only.
It is also a well known FACT that mixed with blacks is definitely less pretty.
Even Tiger Woods and other rich black men, himself prefers a pure blonde. Black men has the highest rate of interracial marriage because their own kind is less pretty and desirable on bed compared to bondes/orientals.
You just have to surf the the online forums, black men themselves find their own kind less desirable than whiter races.
What another idiot! is this what you want to believe? well listen well you pink man dolly, I am not proud to say this but I have dated loads of your so called white women and I have made very little efforts (if any) in doing so. Some how in your hollow head it is the so called black men that goes after your women. No you are wrong, everyone knows that it is the other way around. Your women simply can’t take their hands of us strong bronze men. I once had this ‘white girl’ as a friend, she’s always pleaded with me to take her to one of our African parties in London. One day I did, the party was happening downstairs when suddenly I noticed this friend was no where to be found, in the head of the party I found my way to one of the upstairs bedrooms and Whoa! there she was, your ‘white woman’ fully spread eagle on her back, one black on top while four other black waited patiently for their turn. there are thousands of stories of this nature involving your white women. As for your comments on our bronzy women being less attractive, com’on get real can’t you see just as us bronzy men are no BugFu*kers so are our bronzy women no surf boards or flat saucers. Throughout history we’ve never gone looking for you the truth is that it is you lots that always come looking for us.
Racism is born from complete ignorance. So if you are spouting racist comments you simply prove to everyone else that you are not only lack basic education but you know nothing of the world.
People come in all different shades because, surprise surprise, not everyone on this planet looks the same. The hotter the country, the darker the skin will be of the indigenous people because nature determines this.
The only mistakes here are that the mother had the affair whilst married. The only person that should be angry is her husband. It shouldn’t matter what colour skin the guy has, the fact your wife is sleeping with another man is enough. But this is life, things happen, you learn, you move on.
The fact is, she is half chinese and half american and she seems like a very nice girl.
I cant believe how vile and spiteful the chinese people are towards this lovely girl because of nothing more than her beautiful dark skin. It cuts me right to the bone to think this mentality is the majority in china. why am i not surprised? once again china has shown its complete naiveity when faced with something slightly out of the ordinary. What a shame that the pure ignorance of the chinese really shines through here, the saddest thing is that I am not surprised. Once again china, you have shown your cards and let yourselves down (again) with this behaviour. You should all be ASHAMED!
Eh…”China”? Does dat include da Uyghur and da Tibetan hommies? How ’bout da Qiangs, da Mongols, da Manchurians or da Hans? Seeesh!
How about we start lynching you? Shut your mouth and go back to stormfront.
She’s hot! Plain & simple & her mother should be very proud for bringing her into the world. Get over it, you racist bigots!
I agree, her mother should go make more beautiful black/chinese interracial babies.. Since the other one ran away, look for another black guy.
She’s hot! Plain & simple. Her mother should be very proud for bringing her into this world.
Get over it, you racist bigots!
She should have hit those rediculous Spring Festival Shows where laowai get up and make dicks out of themselves. Her Chinese would rock it!!!
Can’t believe the Chinese comments either. I think the chick is chocolate goodness incarnate. Quite the hottie.
Reading comments like these always make me wonder if China can ever be a truly civilized country and join the “1st world”. Too many people here need a serious change of thoughts and I would LOVE to see the government doing their part in changing an incredibly racist mentality running amok.
And another thing: Before you write shaite about other people maybe you chould check how your male family members here in China behaves. I read studies showing that 73 percent of married men have or have had affairs. Maybe it’s worse when it’s a woman doing it.
I also bet the netizens flaming her couldn’t get a woman like that in a million years.
why would Netizens would want her to begin with?
u should be more wise than reading some ” study” about something that you can’t really or truly measure
I read studies showing that 73 percent of married men have or have had affairs.
You’re full of shit.
That fucking goddamn holier-than-thou face on that fucking cunt of a mother of hers…what I would pay to have the chance to smash it clear in with a hammer.
Yes, like you’ve now smashed China’s good image with a hammer. Nice job, everyone.
wtf
SF
you need to grow up and realise that this is the real world. you can’t go around treating people that way!
leave the girl and here mother in peace.
whats done is dones. its times to get efucated and stop your racsist ignorance!!!
Shut your fucking mixed-race trash mouth. What you are really defending is yourself and your own mixed-black heritage. “What’s done is done.” I guess that can apply to anything in life, any action, any crime, anything! So we should just forget about any kind of justice system also, since “what’s done is done”.
In any case, what’s done may be done, but in this particular case, with a bit of prompt action (and balls, which is something Chinese don’t have much of unfortunately), the mistake can still be corrected. Both of these walking piles of human trash should be eliminated not only from Chinese society but from the human race itself.
If only sack-less retards like you would post your street address on here we could find out if you could put your money where your mouth is… doubt it.
well i guess if stupids people have to be eliminated from the face of the earth…there won’t be one chinese left standing.
we all know that chinese are the single,stupidest people on earth.
Oh Mike Fish, you’re so brave and strong, I guess that’s why you posted your address yourself, to show all the “sack-less retards” here a lesson, and to show them who really has a “sack”. We all appreciate you taking a few minutes from lifting your weights for that…I admit some of us do need to be taught a lesson. Oh, but wait. You didn’t? That’s confusing and surprising. Or maybe not.
Morons who resort to “post your address on the internet” in their arguments are among the most pathetic, hypocritical, and outright idiotic trolls on any forum.
Mike Fish: don’t think to presume anything about others…you know absolutely NOTHING, aside from a bit of text on your screen. And above all, don’t think that you’re anything remotely better, tough guy…just the fact that you’d have the cowardice and lack of self-awareness to post something so detached and juvenile proves that you’re just as much a “sack-less retard” as anyone else here, if not more so.
You are funny… always getting all riled up and angry. The difference is, without your anonymity, you could not say what you do without getting a serious pounding, not by me, that wasn’t the threat, but by all the other people you intentionally offend. I didn’t threaten you, why would I? I suggested your personal information might attract some people eager to kick your ass though. I know without a doubt I could say all of my comments on here to the face of the person I’m communicating with. There’d be unanimous consensus on here that you couldn’t.