From NetEase:
Shanghai “Black girl” Lou Jing becomes famous on the internet
Lou Jing [shown with mother above], who participated in DragonTV’s “Jia you! Oriental Angels“, recently became exceptionally popular on the internet, having been cursed to fame by netizens! Lou Jing was viciously abused owning to her life experience. Many netizens learned that Lou Jing was born after her married mother had [extra-marital] relations with a black man, and let loose a torrent of abuse on the internet. August 30, Lou Jing issued on the internet a stern but fair protest against netizens’ racism, that the color of her skin should not become a target of attack. At the same time, she also said she reserved the right to take legal action.
From KDS:
Shanghai’s most green [cuckolded] man, whose wife gives birth to a black man’s child~~
Lou Jing’s mother had a husband, then had an extramarital affair with a black man, then gave birth to Lou Jing, and then after her birth divorced.
And that black devil, after fucking ran back to his home in Africa.
It is unimaginable how that Shanghainese man [husband], excited and anxious to see his own “daughter”, must have felt when he saw that she was black…
A response by Lou Jing on KDS:
I am DragonTV Angel Lou Jing, and here I make a statement!
- My father is American, not African.
- I am a born and bred Shanghainese person.
- I should not have to bear my parents’ mistake, I am innocent!
- Sternly but strongly protest some people’s racism, my skin color should not become a target of attack!
I reserve the right to take legal action!
Comments from KDS:
hsxxl:
Would this be a green hat or a black hat?
看低2800点:
Her mom really knows how to enjoy herself
erick:
Even going on television…what is this show trying to promote? Extra-marital affairs…?
sara:
This mother is really horny.
Jesse_Q:
Her mother’s skin is pretty thick.
At the time finding foreigners was indeed a fad, but you still can’t pick blacks!
滢滢:
Kao.
Fucked by a black.
How come a zebra wasn’t born…?
黑丫子:
Ugh. Yellow people and black people mixed together is very gross…only black skin, not yellow skin, chocolate skin…
Not even knowing this common knowledge, ruining a child’s life.
Lyna:
There are still a lot of this kind of women that would get involved with blacks~
Her old mother at the time had courage, probably also did not know what color would she would give birth to, white, yellow, all possible, right…?
K-I:
She does not have it easy either.
She’s still better than those men and women these days who treat abortion like a trivial matter.
Moreover, her mother was not married.
If the men in this post are all so enthusiastic about attacking her,
then you guys better take care of your own lives.
小艾Deryck:
Can that black person’s home see DragonTV? …
篮球暴男:
Numb! This bitch still has the audacity to appear on television! I don’t know what to say! One cannot be shameless to this kind of level!
手刹车:
Black people actually have a pretty high standing internationally, many famous fashion models and stars are all married to black people.
However in China, this kind of thing is a little embarrassing/shameful.
Bblueye:
I think this mother is still very great/admirable.
Willing to face her own mistakes, I ask how many TF here would dare to face [such mistakes].
A single mother able to bring up a daughter is already very difficult/impressive, much less one with a different skin color, the difficulties are imaginable.
Everyone has the ability to analyze what is right, what is wrong. Everyone think about it, don’t be so immature, opening your mouth to hurl abuse without thinking. Be a bit more understanding with other people.
伐要弄管:
I think Lou Jing should not be condemned, she herself did nothing wrong, and if her father was an American white person, she probably would not be discriminated against. In the end, it is still racism.
包龙星:
Black people’s tools/weapons are big! Her mother must have been very satisfied! Even having the audacity to go on television! Probably hoping that Africa can see [the television show], and [the father] will come to recognize his daughter, haha!
另壺蔥:
But you guys should not forget…black women’s bodies are the best in the world…
The modeling industry and entertainment industry all have a lot of black women…
一天又一天:
There is news saying that black person is T-MAC’s [Tracy McGraw, NBA player] cousin.
向日葵皇帝:
Obama’s little sister.
Similarities: Male black dog x different skin colored woman.
Differences: Black x White = Obama, Black x Yellow = Luo Jing.
Comments from Tianya:
jiyangjiang:
Having this kind of woman as a mother, truly lamentable.
老实人春生:
There is nothing wrong with the daughter, but her mother is indeed a bitch/slut, married but still getting involved with a black person, probably for the great “love” too. Too bad the black man treated her as a toy. Chinese girls, please have a little more self-respect.
波小斯:
The television channel is also shameless, using this kind of thing to hype/promote/attract attention [to itself].
I imagine her mother is also feeling helpless, bringing out and talking about such a shameful past, and ultimately [in hopes of helping] her daughter.
Miss_Q:
I cannot help but say, those coming out of mixing yellow and black blood are all truly ugly, a dirty feeling [appearance]…
phoenix81:
I do not know why,
but after seeing these photographs, my mind is reminded of Japanese-made adult videos, with the final climax scene of the black man, where the black man’s muscular body tightly pressed on the Japanese woman’s white and tender skin, pulling out after shuddering from climax, and then so many seconds of close-up — of vaginal liquids and semen everywhere.One or several times N years ago, this Lou Jing’s mother along with a black person also played out such a scene.
This black man’s daughter is truly deserving of pity. The mistake is not on her, but on her mother’s and that black biological father.
GOLAKER1:
Girls, you guys should know that even in America, which represents the highest level of black people, 60% of black children are brought up by their mothers alone. Do you understand what this means?
It means the men all fucked and ran, not taking responsibility for anything! There are often black people who have had children with over 10 different women, that American netizens all ask that they be castrated…
藍天白雲輕風:
When I first saw this week’s show, I too was very shocked, so stunned. Society’s norms and values haven’t becomes so “fei zhu liu“, has it? As a post-80s generation, I completely cannot accept this. If I were that girl, I would be so low key that I could not be any more low key. How could I possibly come out and expose my face, seeking attention and sympathy…it is difficult to understand.
美女也爱国:
How much self-respect could the child of a shameless old woman be?
And she still wants to find her American father. Who knows if her father is in jail for being unable to repay his loans or dead from a gun fight on the streets.
Judging by her mother’s story, it seems like her mother was not very familiar with her American black father anyway, so trying to find…America’s already has a bunch of black children trying to find their own biological fathers.
yimihai:
I am not racist, but if her mother really was married first and got involved with a black person, then that is indeed low. What more, not knowing to use contraceptives or abortion, could she have really been thinking of using a child to tie down a foreigner? Truly both low and deplorable.
The child is innocent…
090902 UPDATE: Here is a video of Lou Jing:
Related Posts:
- Chinese netizens comment on a rare Chinese male, black female couple photographed on the Shanghai Metro. Some joke that Chinese men cannot possibly satisfy her. » 168 comments
- Chinese netizens reactions to a Chinese female & black male couple found naked and fooling around publicly while underground rafting at an scenic/tourist area. » 265 comments
- A 3-year-old Yunnan Chinese girl is in the hospital after suffering long-term child abuse living with her aunt while her parents were away working to make money. » 67 comments
- Young Chinese girl meets 18-year-old young man on internet, soon forced to stay with him for over a year. Judge blames parents for not teaching her properly. » 100 comments
- Young girl forced into men's restroom at restaurant in Shenzhen, China by 58-year-old government official, who arrogantly dares people to do something about it. » 100 comments




Com’on – there’s just no sense at all to that stupid topic.
Having a cheating wife sux – doesn’t matter if the fucker is black, white, pink, whatever ;p
DAmn!!!! how could you be so right, PONTI!
i hope u r from china or shangai cause u seem to have a clear mind and seem to be one of the rare healthy person of this website.
Why chinese dislike like this black people?
I am an Afican American/black woman.
I am glad that I had a chance to read the comments that Chinese people made on this web page.
First, let me explain that I do not think that racism is wrong. I believe that bigotry is wrong. Chinese people have a right to keep their race pure.
It is shame that black people do not think like people from Asia and the Middle East. Jews, Arabs, Indians, Chinese, Pakastanis, all are homogenous and believe in marrying, breeding and keeping financial matters within their respective clans.
While I am very hurt that so many Chinese people on this post see black people as animals, I am also glad that I saw enough proof of their hatred for black people that you will never see me in a Chinese restaurant again.
I have a $100,000,000.00 lawsuit (please visit http://www.thecrimesofsenatoruzamere.com/lawsuit_for_fraud.html for more information). If I ever win that money, you can best believe that I will use my last breath to create a little community of blacks who don’t mix with Asians and Middle Easterners who hate us and see us as black, ugly “lo fah.”
Ahhhh, a purely black neighborhood where even the sushi and lo mein are made by black people…a neighborhood where I never have to run into Chinese people who hate me…I can even print this site and pass it around to the blacks who still stupidly go to buy Chinese food.
I know it’s a stupid dream…but I can dream, can’t I?
Although you are clearly upset, and you have the right to be, your comment is just as ignorant and racist as the negative comments people are posting about Lou Jing.
There are many chinese people who do not feel this way about blacks and are actually open-minded enough to not feel this way. Your comments about creating a “community of blacks” and boycotting chinese food just shows how you are stereo-typing all chinese.
The treatment Lou Jing is getting is obviously wrong and many of us believe this and support her in her endeavors. You say that you will not go to any more chinese restaurants, and what about other chinese businesses? Your association with chinese people and chinese food only shows how ignorant you are. Chinese people are not ONLY GOOD for making chinese food. For you to call out not only chinese people, but all “middle easterns” and grouping everyone together is not only racist but a fine example of why this world will always stay the way it is–filled with hatred and retaliation rather than understanding.
If you want to make a comment or express your feelings, please do not stereotype. When you do, people stop listening, realizing that you are only furthering the racism that fueled this in the first place. I wish I can respect your comment and opinion, but because of the ways you have stated them, I cannot support them or even say I understand where you are coming (although I have experienced racism many times).
Your “dream” is one of a world that is segregated. Neighborhoods that are “purely black” or white or chinese, etc. would erase all of the historical and social changes that the few courageous men and women have contributed to our societies. I forever hope that this dream of yours will be just that–a dream.
The Problem is that Chinese like most Asians are totally ignorant when it comes to race. Sure, we should all be proud of our racial heritage and culture, having said that. As an Black American who has a biracial child, I know my daughter is beautiful. There is nothing wrong with being Black, White or Asian for that matter. What it boils down to is jealousy. Most Asians are small-minded thinking when it come to race and Blacks in particular. We are are equal. NO asian person would or could ever make me feel inferior, in fact, I laugh at them, because it shows their own pathetic insecurity. How does skin color equate ones intelligence?
So if you are blind and a Chinese person and a Black and White person were in the same room and had to touch each other, there is no way you could ever tell who is who! What makes White skin better? That makes you a better Homo Sapien?
Chinese people hate themselves, it’s a known fact, because if they didn’t, then why do they have to bleach, change their breasts, nose, cheeks etc.? For what? A confident individual would never want to do that. I can see if it is a life-threatening problem, but on the level that Chinese do it and think that the White community will accept them, is so over the top ludicrous! I would never, ever, ever want to be Asian or White. I thank God everyday for making me, me. I love myself a lot. I never hold my head down and have the utter most confidence, because if someone that doesn’t like me because of my color, then that means, they fear me. And that feels good. Stereotypes are sometimes overrated and should not be taken seriously, you good people in every race, but a Black heart, and Asian heart are all the same, if you do an organ transplant, no ever asks, “from which race did this organ come from?” It doesn’t matter. We are all coming together faster than we can think and if China, the growing superpower wants to act in a real sincere and responsible way, then that means, they also need to grow up and understand, the world comes in different colors and races and religions and it’s Ok to be different and that one race is not superior to another. Because if you think that, then that makes you the lowest and most ignorant person, period! I hope more people mix and become one, that way, all this foolishness will stop, but on that point, many Asian countries are still adolescent in that regard. One thing is for sure, when we die, we all go back to being the same….dirt!
Cheryl don’t be discouraged. China Smack basically cherry picked the few bad comments to make the story more than it is.
I found these comments from the same KDS thread China Smack cited. There are LOTS of comments supportive of Lou, and against racism. I really don’t know why they are left out:
“不要去歧视外地的,大家都是平等的” – don’t discriminate against outsiders, everyone is equal
“小黑是无辜的” – Little Black [Lou Jing's nickname] is innocent
“这个小姑娘是无辜的,大家积点口德” – the little lady is innocent, everyone watch what they’re saying
“我觉得这个母亲还是很伟大的” – I feel Mother Lou is quite admirable
“小孩很可怜从小被歧视” – poor girl’s been discriminated since little
“以后碰到你身上 你还能噶笃定” – wait til it happens to you, will you be so self righteous
“单身母亲还是要理解的” – single mothers need understanding
“小孩没什么错,大家别这么刻薄” – kids are never wrong, everyone stop being so harsh
“大家不用这么说人家小姑娘吧” – people, there’s no need to talk about her like this
“怎么说她也是讲上海话的土生土长的上海人” – no matter what, she is a local born and raised shanghainese
“何必要这么搞臭人家呢” – why poopoo others like this?
[Note from Fauna: Please do not continue to post comments with different names.]
are you an idiot??? you definitely sound like one.
It’s people like you that keep the black community down and the world in general.
Become enlightened.
Hi everybody,
I just want to say that I didn’t know Chinese were so racists. I’m an African girl who lives in Belgium: I have never seen so many insults on black people in my entire life!!
So what? You think you are better than us?
Just look at your country where you can’t say what you’re want about the government! You are slaves of your president or whatever and his guys..
Many of your people work for almost nothing, you have children who don’t go to school…
You’re think you are better? More beautiful? Come on! Just stop dreaming: if there is a quizz with Black women and Chinese women in all over the world, I bet black women would win…. Don’t misunderstood: before I read all the bullshits I wasn’t thinking of that, but know….
Oh and yes, do you think Black people like you that much? Are you kidding? Just continue to be racist in your country beacause all of you who live in the USA: You have a Black man as presiden, how does it feeLS?
Sorry, but I can’t let it go…
I have to at least write something…
I don’t care if you inderstand: I’m just angry!!
C’est quoi ces attaques racistes?
NOn, mais je rêve: vous avec vos pauvres vies, à cause de la souffrance que vous avez causés à cette fille et à sa mère, vous serez jugés!!! Et j’espère que vous aurez l’occasion d’aller rencontrer votre père adoré- le diable- en enfer… Il vous accueillera les bras ouverts…
Vos blagues sont pourries, sans compter le fait que les chintocs n’ont rien de bien spécial ) part un pays qui prend de la place pour rien!!!
Continuez à nous fournir des marchandises à bas prix et des films de combat et fermez-la.
Peu importe ce que vous pourrez faire, vous n’aurez jamais le prestige d’être respecté. Vous garderez toujours votre imege de mains d’oeuvre à bas prix!!
You people are a complete disgrace , you have Chinese people working in all parts of Africa statements like the above would put Chinese works in Africa in danger, This girl is Goods creation more importantly she is very beautiful
Its 2009, grow up people things happen in life and love and she is here and she breath’s and has feelings, hold your head up Lou and be proud of your heritage, I am glad you grace our planet and I must say you are simply stunning!
damn china
u racist
i know right!!? fuuuuuk..
it’s insane aye? i cant believe how many racist comments are on here, who cares if shes half black/asian? she’s HOT! (but even if she wasn’t, it doesnt make any difference). AND she’s confident enough to get out there and enter a talent contest.
all of the assholes who think its ok to abuse here because of her mixed race should find something better to do with their time.
AND Cheryl D. Uzamere is just as bad. if you believe that creating a seperate society is the answer then i will tell you now, you are wrong. just because some people discriminate against you doesn’t mean everyone of that race does.
acceptance is the way forward.
just FYI:
mix asian/black/white/whatever = hot
Igat! As Chinese, I think she’s sizzling hot. Who cares what her mother did. Human emotions and relationships are complicated enough on their own. It ain’t the daughter’s fault and she can sit on my bachelor lap any time.
People need to seriously lighten up. Some of those commentators ought to consider what their comments say about themselves more than anything else about the state of the “morals” of society or what that lovely, beautiful lady should or should not feel or do.
Ye who is without sin shall cast the first stone (or some such). Or maybe bring back the revolutionary self-reflection education classes.
You took the words right out of my mouth. thank you
Phew! So glad I’m not the only one who thinks she is hot! Damn, Lou Jing!! You should be a model! Don’t let these dumbass Chinese racists get you down. Follow your dreams, and I hope the whole world gets to see more of you.
-An Indian guy.
Thank you. Finally some evidence of sanity on this crazy fucken forum.
One thing to say:
http://www.youtube.com/watch?v=VUcNxhGoaEI
Those comments are unbelievable racist and ignorant. Even though I knew most Chinese are racist towards black people I am still shocked at reading this.
The girl looks beautiful and she shouldn’t be blamed for a mistake her mother made such a long time ago.
Its important to remember that there’s racism as reaction and racism as a mode of thought. Chinese aren’t necessarily against mixed blood couples; it was the adultery that led to racist comments.
I don’t buy that distinction at all. Racism is racism, so-called “racism as reaction” betrays racist modes of thought. Obviously, the adultery is a factor in the outrage of the commenters, but so is the racial aspect, obviously.
If this girl’s mother had had an affair with another Chinese guy, would we even know about it? Would it ever have ended up on this site? Would people be saying she shouldn’t show herself in public?
These are rhetorical questions, because everyone here knows the answers,
You’ve lost me around the second corner there bro. Waaay to deep for this site me hommie. All I can think of right now is how she’s stirring me Chinese love around and around…… Oh the sweet vertigo….
You took the words out of my mouth, ChinaGeeks!
if only i could vote for you 100 times!!
Here’s an example Charles
“I am not racist, but if her mother really was married first and got involved with a black person, then that is indeed low.”
He claims that the big problem is the adultery, but why did he have to mention “black” in that sentence? (I’m always suspicious of any comment that starts “I’m not a x, but…”) I’m not with you on this one at all, I feel there’s still a long way to go before Chinese people are more accepting of African American/Canadian/etc.
I agree here that racism is the pivotal issue that entertains this story. However I can also understand the other Charles’s view that most Chinese racism is dormant unless activated by certain situations. In other words, Chinese are latent racists but are good at concealing it.
I don’t think any of this makes it look like they’re good at concealing it.
Maybe you mean, they’re racists but they remain passive aggressive about it.
Ahhh! So that’s what political correctness is for is it? “To conceal it better”. Man, da chinkies need to get themselves some of that fabulocious goodness. Very modern and scientific that, non?
Ahhh, so seems like political correctness is good for concealing racism is it. Man! Da chinkies need to get themselves some of that fabulocious goodness. Very modern and scientific, and very fashionable too, like da people in da West already do, non?
Ooopsala! Double post…me bad. Yikes!
accepting of Canadians?
Yeah I’m not racist either, but those Canadians they’re always talking about their Hockey, drinking their Molson, saying eh and being unable to pronounce ‘ou’. Fucken frostbacks.
Frostbacks!! That’s awesome. F*ck Molson, by the way :)
Bollocks. What about all the comments that make no mention of the adultery and simply say things like: Ugh. Yellow people and black people mixed together is very gross.
It’s racism pure and simple. It’s not the violent, KKK burning crosses on your lawn style of racism, but the far more insidious kind that holds that black people are somehow dirty or lower than others due to the color of their skin.
I agree with you totally. The type of racism that happened, and still happens to some degree, in the US is of the type where there is some balance, where a large percentage of people who are white find it appalling and blacks have some say in matters and over time affect changes on the culture.
The racism here in China is so ingrained that people here are not even aware of it. Look at what the netizens here had to say about Condolezza Rice when she came here. Lowest forms of insult. Ignorance. Yet Chinese people will always deny that they are racist. Look at the US Olympic team and the Chinese Olympic team. Did you see one black person on the Chinese team? One white? One brown? And if China had let a black runner on the team what do you think the national response would be? ugly racist remarks like this. And further more, these poster have no shame, no ability to search themselves and make changes or grow. Pathetic.
yea
USA is soooo NOT racist towards asians or chinese people
why dont you open a book and read some history about how USA treated and still treats Asians or chinese people to this day
Would USA Olympic team allow someone who is asian?
More like you have a ton of white-black race based murders. China doesn’t.
China has China-China based murders.
Da Sherlock Holmes is in DA HOUSE, ladies and gentlemen!
Eric: The US has many asian members in their olympic team, dumbass
Eric you are such a little dick minded jerk. The U.S Olympic team is amongst the most diverse in the world. You would like to point out how America treat china. Just look at how china treats fucking china people. Go to china speak with the same privelege here in America and get you ass cained to death or have your family imprisoned or killed. Chinas cultural views and fucked up conditions can’t even hold a fucking match stick to the priveleges here in America. Dear you speak against your own goverment if they pissed on your mother, less you want your fathers nuts cut, you dog. I’m sure your most likely on American soil talking your shit, you low Dog.
She is a very beautiful young lady. I don’t see that her mother made a mistake. Children are not mistakes; when we treat life as if it’s disposable, you see behavior like this.
I’m rather disgusted by the comments that I’ve read here. Really, it turns my stomach.
Same racism as I saw with the Japanese.
By far the most lucid comment here.
My 1 1/2 cents
I think sometimes it is difficult for Chinese people to show tolerance and charity where it is due. From my perspective they seem to have a lot of social pressure. In this case there is talk about ’shame’ and that this person should remain invisible. There are a few folks who excuse her with more or less empathy or good intentions, but very few with admiration or that are really egging her on to ‘go for it grrl’. Don’t forget, though, that she got this far. There must have been support too!!
[comment hidden for too many negative votes -- click to view]
Those comments are unbelievable racist and ignorant. Even though I knew most <> are racist towards <> people I am still shocked at reading this.
Blacks held in higher regard internationally? Really? Which civilized countries are you talking about?
It certainly can’t be any country in Africa. Generations of genoicide, raping of women as a tool of war, billions of dollars donated by other countries only to see people in charge take care of themselves, etc etc etc.
Asia, the only country that looks down on the Chinese is Japan, but we all know their incentives for that one.
Americas, roughly 70% of all convicts in the US are blacks and 70% of all black males ages 21-27 have been or are currently in jail. I haven’t even touched the tip of the iceberg here.
The worst stereotypes of China are its inferior products and manners, but the Chinese sure have a shit load of positive stereotypes as well. I can only think of one when it comes to blacks.
It seems like maybe when you were typing in http://www.chinasmack.com, you meant to be typing http://www.stormfront.org. Maybe you were saying something to someone when you were typing the address? That happens to me sometimes, where I’ll be talking to someone but trying to write something else and I end up typing what I say.
I’m really curious as to where you got those statistics from. Judging from the smell emanating from them, I’d have to guess your ass. The majority of crimes in the US is commited by whites. While a higher number of blacks as a percentage of their general population is incarcerated, the vast majority of violent crimes are commited by the white majority.
Regarding your comments about Africa, I really suggest you educate yourself on African history.
That’s wrong too.
http://www.ojp.usdoj.gov/bjs/pub/pdf/p05.pdf
There are a lot of reasons why, including class, family and other considerations – but black Americans do commit the most crimes out of any race. Not 70% of the crimes, but they are much more highly represented in jails than white Americans.
Or they could simply have been subjected to racial profiling, real or subconciously, and much more frequently targeted for stop and search, as in “yeah, it was a Black Guy with Gun (BGG)”. Then booked for minor infractions when if it was a seemingly well mannered white or geeky asian dude, they would’ve more often than not be left off with a caution. And once da big o’system gets ya, ya’re up da shit creek without a friggin paddle.
Lazy ass statistics are a dime a dozen, gimmee the juicy and meaty long stories behind it.
These are Department of Justice statistics about jailhouse populations, not misdemeanors. Yes, there are problems with racial profiling (and other things i noted), but it’s ridiculous to dismiss statistics just as much as it’s ridiculous to live by them.
Ahhh…very goody you got da point there E. Wanna join me for some hoomp-a-ding-ding?
Really? Did blacks drop bombs on Hiroshima and Nagasaki?
Did blacks murder 6,000,000 Jews in Germany?
Did blacks declare war on Vietnam?
The men in jail in China — are they black?
Bernie Madoff, the man who ripped off 5,000 people — is he black?
The Enron scandal, the Adelphia scandal, the worldwide financial scandals that drain thousands of people of their money — are they black?
The tongs who bring opium from China to sell in the United States — are they black?
The same tongs who force many Chinse women into prostitution in the United States — are they black?
Just thought I’d give you a few things to think about, you stupid muthafucka’
One more thing: It is not hard to learn how to cook Chinese food. If I ever get the money I need, there will be NO Chinese restaurant in my neighborhood.
YOU ARE A CELEBRITY!!!
WOW.
CELEBRITY COMMENT WAS TO ELAINE.
SHE IS CELEBRITY YO.
I KNOW, I’M ALSO CELIBATE.
Accept the facts. These were released by the government roughly about 5-10 years ago. Even Obama has come out and spoke about the problems that African Americans in the US represent. (NAACP speech)
Are you saying that Africa hasn’t committed these atrocities to each other?
Educate myself? At the very least, I can read and understand what others are writing. Even the shit that comes out of my ass has a higher intelligence than you.
Do I hate blacks? No. Do I have black friends? Yes, but I’m certainly quite aware of the social problems that the US has and African Americans play a big part of it.
A! i like you a lot!
I agree with “J” and I am a black woman(currently living somewhere in Asia) from an African country ! I will also admit , I hold Asian people in higher regard than my “own” people…
which country in africa, nigeria well in that case stop lying you not un african
1. if you are black your pathetic
2. holding chinese people higher than your own race is just self hate
3. i feel sorry for you, and
4. have a nice day =) haha
The first race was the black race and the last race will be the black race… just so all of you know. So let everyone talk now because we are and will always be whats good.
I have to enlight some of you Chinese, I am a soul brotha # 1, that’s obvious not my name, but call me that..sound good? I was in a small furniture store- P.S. Discount Furniture, Pasadena, Ca, to be exact. There was a nice older Chinese lady and her hubby working there.I found something interesting, and it wasn’t the furniture,either.I browsed for about an hour or so while this lady watched me, staring. Her hubby went on a long delivery, I overheard her say “Go to Ontario”. After he split I asked her about a foot locker she had. She walked over and said, ” you like?”. My c%$k swelled up instantly.She was shaking.I looked to see if there was at least a little gap,..nada. I put my hand up her thigh all the way to her “pewsie”, thats how she said it, cute…,anyways. I told her I want to play a game.She said huh?. I said it’s my favorite…WHFTB.I showed her what it stands for.She now has quite a bit of daylight between the arches. I wonder if hubby notices the roomier enviorment. I picture him saying, ” What the Fook?!” True story..I have a few more..
“Asia, the only country that looks down on the Chinese is Japan, but we all know their incentives for that one.”
Ehh…no, that would be a no, no, no. HK and Taiwan are looking down on ‘mainlanders’…but as you consider them part of China, what about Korea or Singapore…any developed nation look down on Chinese. This can’t possibly be news to you?
Koreans look down on any and every other single race/ethnicity.
Singapore isn’t worth mentioning in my honest opinion. They’re the equivalent of the Chinese when it comes to morale and ethical issues. However, because of their stricter laws, they appear more civilized. Go spend a year in Singapore and you’ll know that it’s about the same.
HK, thinks they’re better and manner wise they’re a bit better. But that also depends on who you compare HK to. If it’s Beijing, no. A hick filled village, yes. This is the biggest problem with China right now. There are too many uneducated hicks running around ruining the image of the country.
Taiwan . . . not really better. Southern Taiwan where the “true Taiwanese” are located are little better than village hicks form the main land. They just pretend they’re better, but they’re shit too. Look at the last President of Taiwan.
I will agree with you on this issue. Blacks as whole are not held in high esteem and I do not feel that that is because of their skin color but because of the violent attitude many black people can have. I do not see Chinese people as a whole as violent or dangerous as black people. All races can have pros and cons.
“the violent attitude many black people can have”
What in the hell are you talking about?!?! You do not see Chinese people as a whole as violent or dangerous as black people???!!! These comments belong up there with the ignorant Chinese comments about the young girl. Obviously you have not seen a gang of guys beat one man to the point of death. Where has this happened? In China. Perhaps you haven’t heard about the husbands that rape their wives in rural villages. Or about the countless other crimes that go unreported daily in this country. Open your mouth when you speak, not your ass. You are grossly misinformed and for lack of a better word, a complete MORON. I am a proud African American and I will NEVER be ashamed of my people no matter what the socalled “statistics” say. Do blacks commit crimes? Yes. But for a group of people that are STILL not treated equally, what can you expect? Is it an excuse? No. But, again, I will say you need to know what you are talking about before you open your mouth.
The wise has spoken tell them , the most important thing is we should not argue with this people too much because they can’t see the truth and chinese or asians in general are best people in force pretendence and and hiding evil did the real luciferic way, they can’t accept that most evils done in this country is evil but only can show example of africa personaly i agree in most societies we have good and bad people, but the truth is somebdy never seen a lot of incedence happening in china ,chinese people killing each other only for small reason like( you hit somebody on sideway walk ) most of them tend to carry small knifes which known as chinese guns, most people in here are misinformed and don’t know a shit about chinese life and societies ,most of rape cases between uncles and nephews cousins and brother and sister those are good quality for them, what happen in here are more worse than even what happen among black societies but just because they hate black ,they legaglize the sin in their societies and wash from black people,ask them who made those statics? is he/she black? the answer is no so what you expect them to say? accept that they commit crimes never, you know fun enough egyptians pharaos are presented in white or arab faces is it true? if they can change that great history you expect them to say they commit crime? most people in here are just like football fans just want to comment without knowledge
peace en love man
in that case your right so we all fall in same category but it is just one race with high number , not bad
Sorry I must disagree with you. The problem is that Blacks are not as violent w/attitudes as most people believe. The whites/kinds are for more violent and have very self center attitudes it all about me .Case in point look at the majority of the World Wars.
To hell with your comment you fucker of racist.all this balck doing great around the world are droping from heaven? are they not from Africa.How about your morthan day genocide.All you need in Africa is there resources and exchanges it for Arms.color is color!the worst you commited in the world is morthan any black.you can cover up your bad deed and opens others.Beside you peoples means nothing to Africa and expect and just mother fucker racist.
[comment hidden for too many negative votes -- click to view]
please display this research, to promote our cause. Because when in the sauna, this is not so…they cannot find yours
didn’t mean to vote positive! you suck hello friends!
J, please inform yourself. Where are you getting these statistics from? That more blacks than whites are not given parole or are given stricter sentences for the same crime seems to skew these statistics. I did a report on crimes in America, from thefts, to rapes, to murder. More blacks are convicted of smaller crimes but are given longer sentences versus their white counterparts. Blacks are being marginalized more in the US, which again plays to the racist tendencies of a bigoted country. If only the rest of the world would learn from America’s mistakes and not repeat it.
Again, please inform yourself before throwing random stats and proclaiming them as fact.
J says: Americas, roughly 70% of all convicts in the US are blacks and 70% of all black males ages 21-27 have been or are currently in jail. I haven’t even touched the tip of the iceberg here.
In reality, ” About 10.4% of all black males in the United States between the ages of 25 and 29 were sentenced and in prison, compared to 2.4% of Hispanic males and 1.3% of white males.”
A disproportionate amount of black males are in jail, but it’s no where NEAR what you’re saying. In fact, the majority of prisoners are white.
In fact, the majority of black prisoners (and prisoners in general) are in jail for drug related non-violent crimes.
I sincerely Hope that Helps, Retard.
Hey you,
what are you talking about?
Forgotten the students who had been killed in China?
Mao? AND ALL THE STUFF? ComE on… Don’t think China is an exemple…. Don’t!
No offense, but:
3) Black people are the lowest of the low in social ranking internationally. This is largely due to the political and economical situation in Africa.
One of the reason that this story cause so much reaction on the Chinese forum, is that Chinese people believe in “marrying upward”. Which is why if the father have been a white guy, this story would not cause so much reaction. But the fact that her mom cheat with a black man, it makes Chinese wonder: why?
I have no opinion on this story, I just want to clear out your confusion.
Ya, I’m all clear now.
@Ming
I agree with you. The low social, economic, and cultural level of blacks in Africa contribute to people having a low opinion of blacks. Until the African/black political and business elite clean up their act, their people will always be looked down upon.
This situation of looking down on Chinese by whites also existed in the US. Chinese were considered weak, dirty, and uncivilized.
It was only after Chairman Mao established the PRC did the white world realized that the Chinese now knew how to fight and could not be bullied any more.
(This same thing applied to the Jews. They were once consider weak and dirty and despised by everyone. But once the Jews established the state of Israel and fought several wars and defeated the Arabs, the world realized the Jews now knew how to fight and would not be bullied anymore.)
In the US, it was against the law for a Chinese to marry a white person until 1967.
When Bruce Lee married a white woman, many whites made disparaging remarks about a white woman marrying a Chinese, just like the comments directed at this young black girl’s mother.
Irony of ironies, the US had several Chinese communities in the South where Chinese men married black women because of the restriction on Chinese women entering the US. Today, there are many “black Chinese” descendants from those relationships.
http://www.oah.org/pubs/magazine/asianamerican/vivian-wong.html
Tom Bradley, the five-times elected mayor of Los Angeles, is of black Chinese ancestry.
http://books.google.com/books?id=JBiB_Mzsa2kC&pg=RA1-PA134&lpg=RA1-PA134&dq=black+chinese+texas&source=bl&ots=RNQqT92qbJ&sig=-_tiljgUoqOr0Fw8QIpaO1zpOe0&hl=en&ei=EcqfStuoHYiO6AOA3pzwCw&sa=X&oi=book_result&ct=result&resnum=8#v=onepage&q=&f=false
It’s amusing and pathetic to read the ranting of the ignorant and the stupid. This is the drawback of democracy and the internet.
I’m glad you didn’t participate in this stupid discussion.
but do you know what african or black think of you by calling them low, your an idiot your high right in which case just tell how higher your?
ATLEAST FRED YOU TALK WITH POINTS BUT NOT MING
Yes. I do believe that in hierarchical Asian countries, the whole world is ranked from top to bottom. No one wants to associate with ranking below one’s own.
This is a drawback for many Asian countries. It promotes outrageous racism. Also, it exacerbates superiority and inferiority complexes. That is how oppression works.
So, coutries that rank higher are constantly chased and there is a great feeling of inferiority towards them. Hence, the better looking white woman lead Asian women to perform ridiculous surgery on there eyes so they are not slanted. Absolutely ridiculous. Now, for the coutries that rank below, people feel self-righteousness and a superiority that they are better.
Their system is their own private hell. Misguided superiority and exaggerated self-hatred tug them at both ends. I hope the rest of the world isn’t headed in this direction.
Next, there has been a discussion of black people in prisons. Think about it. People who have to deal with this type of racism for no reason other than skin color, how would you be if unfairly treated this way.
The best situation would be to take the racists of the world and isolate them on another planet. Then they could drive each other insane with their hatred. After all, people like that deserve each other. They could rank themselves there.
It is manifestly untrue that internationally, blacks are held in higher regard than Chinese. I cannot think of anything more false, in fact. How can anyone think that ? It seems that someone who has never set his foot outside China is allowing the Hollywood media to shape his opinions.
Chinese: law abiding, intelligent, self reliant, hard working.
Black: Put “not” in front of each of the above.
ChinaSmack should just take comments like these off the site, not “hide” them and allow a simple click to reveal its contents.
You are soooo… right MJ. She does look better than most Chinese women. Some black man with money needs to go and get here and take her away from all the haters over in China. I bet she will make beautiful babies of her own. I also believe that her mother just wanted to experience what it would be like to be with a black man. She didn’t want to leave her husband.
Btw, in the Caribeans there are lots of people with Chinese surnames, being descended from inter-marriages between black women and Chinese men, like Edouard Wah or Naomi Campbell. Then there is Jean Ping, the Chairperson of the Commission of the African Union.
With China’s increasing role in Africa, there is likely going to be even more mixed race children. So welcome to the gene pool, especially if they are as hot as Lou Jing. Or Fabulocious! as they say in Jamaica.
You mean to tell me her despicable mother didn’t even buy her an parasol after she was born? Shameless.
I really don’t understand why Chinese always talk bad about the Japanese, Korean and vice-versa because it seems to me that they have the same mindset, to keep the race pure and don’t breed any mutts… to hell with that racist shit! racist people are the lowest piece of shit! Biracial children are just as beautiful!
Eh…OK lets generalize all 1.3 billions+ Chinese shall we. Man! Christ on a stick, some of the comments here are as bad as those above about Lou Jing. Lighten up peeps! Spread da LOOOVE!
Or better yet, let me spread me looove all over ya…
Come back to bed baby and spread your love all over my anus…..
*sniggers* Quel q’un douche est muy sensitivo. Was fuer ein Arschloch! LOL!
Tiger Woods is black / Thai. Kimora Lee Simmons is black / Japanese and was modeled for Chanel in Paris. Tyson, the male model, is black / Chinese.
Since when was it “common knowledge” that Asians and blacks make “gross” babies?
I was at a conference overseas and some (embarrassing) fellow Chinese kept standing up to condemn American “hegemony.” Had no idea what the h*ll she was talking about.
Americans have long embraced difference. It’s the Chinese who insist that everyone is the same! One race, one country, one Party…
I hope these comments are from crazies on the fringes of society, and that the average mainlander is not this ignorant and racist.
Tiger Woods is black?!??!?!
NO…he’s a rainbow because the sun came out after his mummy and daddy made lots of rain…
I think he is like a quarter black or something.
I read comments above from Tianya and netease and I feel ashamed of my fellow Chinese people. Not to make excuses for them but even for America, arguably the most diverse and open country in the world has had lots of problems with racial conflict/discrimination, and China is much more monolithic when it come to race with ~90% Han and probably 99% Asian population. It’s easier to discriminate when no one knows anyone from a different race.
and btw she is smoking hot!
“Ohmygod! A black person on Chinese TV! I can’t accept this modern society! Help me!”
Just kidding. Those comments crack me up.
Wikipedia: Woods is equal parts Chinese, Thai, and African American. But whatever.
w76 — you’re totally right! How many Chinese descent from concubines, or mistresses that cadres keep in “second houses”? People are naive if they think everyone on TV comes from some pure background.
he’s 1/3 thai, 1/3 chinese and 1/3 black? i mean, i can see how mathematically that could happen, but it strikes me as a little unlikely.
LoL Kellen
Since a child always comes from two biological parents, one can only be portioned into traditional categories of race with denominators in the powers of two.
what Panic! meant is that tiger woods is equal percentage (25%) of thai, chinese, and black, but that’s not all he is, evidently he is also 1/8 native american and 1/8 dutch.
There is a pretty interesting article on his race defined in a multiracial america.
From Salon.com
http://www.salon.com/april97/tiger970430.html
Yeah I agree with you, every country has problems with race, but I find it worse in China regarding black people. I saw these wall hooks for sale in the supermarket a few years ago with little pictures on them – cartoon versions of black people with hugely frizzed out hair, massively puffed out lips, dazed looks in their eyes and bones through their noses! As many problems as the west has with racism, that would never fly in a normal supermarket over there.
Duda, chill man, lighten up. It’s call comics, caricatures, exagerated imageries whatever. Life would be pretty boring if you take the pc crap too far without considering the context.
I mean seriously, imagine no manhua/manga, Disney, Marvel, DC or Dilbert. Life just ain’t the same.
I like your laissez-faire attitude Gaad, you seem like a fun guy. You’re pretty off base to compare the picture I described to manga, disney and dilbert though.
Ahhhhh!!! I sooo like you too Tic. Let’s all hold hands and sing Kumbaya and have a lovefest now shall we?
Yeah, Tiger Woods mother is Thai and his father is black African-American.
what are you smoking?
America created institution of racism. Maybe you should read some history at how USA treated asians and chinese
America hegemony is disgusting
Racism was around long before the United States of America was founded.
Perhaps you should read a history book, dumbass.
“America created institution of rascism” – that has to be the stupidest comment I’ve ever read anywhere in my whole life. You’re not Eric Wong / Smickmo by any chance are you?
Ok, Joke-time is over. I’ve seen comments comparing people to animals (some of which I’ve written) — and THAT was the stupidest comment you’ve read anywhere in your WHOLE LIFE? Based on the fact that you are possibly a Teacher, you yourself take prize for stupidest comment. We all know that America was the first to industrialize the institution of racism. This gross indecency in Chinese thought, I speculate, would not exist at this level without Western mass media’s teaching prowess. There were racialist institutions, that’s a given — but the filth of China is of such a gross and cookie-cutter magnitude as to suggest an offshoot of the American “phenomenon”.
“We all know that America was the first to industrialize the institution of racism.”
Firstly, who is “we?” You, and who else? The US WAS NOT the first society of people to enslave others. You are saying that the US, a nation not even 250 years old created the “institution of racism?”
The institution of slavery is the beginning of the “racist institution” you speak of. Racism, then, can be traced all the way back to 1760 BC. In the Code of Hammurabi, slavery was clearly part of the Babylonian civilization. Slavery also traces back to the Sumer, ancient Egypt, ancient Greece and ancient Rome.
Where are you getting your historical information from?
Racism is older than America.
Btw can’t ChinaSmack translate some of the supporting comments on the Oriental Angels website too for a more balanced view. Tata and cheerio matey.
Oh boohoo, look at us the poor Chinese who have everyone being racist against us. And when we get the chance, what do we do? Be just as racist, if not worse. Goddamnit their level of hypocrisy goes beyond childishly excusable sometimes.
Oh Mon! Looksy like I need to spread some of me precious Chinese love all over you too eh?
Yeah because Chinese people are to blame for the Holocaust. Chinese people are to blame for genocide of Native Americans. Chinese people are to blame for lynchings, Jim Crow, church burnings. Chinese people are to blame for the annexation of Texas and California. Chinese people are the ones occupying 100% of the world’s best land and 30% of the world’s total land mass.
Get a clue idiot.
Chinese people are to blame for the Cultural Revolution, The Great Leap Forward, The Tianmen Square massacre of 1989, etc.
U forgot to blame Chinese people for yourself too.
Blame Chinese people for myself?
What does that mean?
I’m not Chinese.
Are u sure? Are u very, very, very sure? Go do a DNA test fer u’ll find it most illuminating.
glad to see u recognise that not even 1% of china is not a dump
agreed
So, Lou Jing’s mother bore her lover’s child, she isn’t the first woman to do that and she won’t be the last.. on the other hand, she should be praised for choosing life and raising such a beautiful biracial daughter in a homogenous society while having to face being stigmatized. I can’t even begin to imagine all the racial slurs, disaproving looks and evil gossip she and Lou Jing must have faced on a daily basis. I commend this brave and proud woman. She did a mighty fine job of raising her child to become a beautiful, young woman despite all the hardships they must have faced and will continue to face through out their life.
Hear, hear. How many generations before we get common thinking like this here?
Heavy metal is the law.
Lou Jing’s skin-colour is approved. Black is metal.
Lou Jing’s music is not approved. It is pink and ugly.
Read about crabcore and China at http://chinosophy.blogg.se/
Welcome to Hell, every one.
The LACK of racism in this country is amazing. I might just live here for the rest of my life because I absolutely despise the completely racist Western country I originate from.
If you don’t get the sarcasm in this post, turn off your computer, go to the bookstore/library, read a f’ing book and learn something.
Most black guys are incapable of maintaining long term relationships. I’ve seen it happen a million times. They stay with a woman until she’s pregnant and then there on to the next one.
Most people like you suck a lot of dick and like to give rim jobs to down and out people who haven’t washed their asses for decades.
Been married for 20 years. Have 4 brothers all in similar long term situations. That’s 5 out of 5. Your statistics are pulled right out of one of your homeless lover’s asses
Woah! Easy there friend, angry black man stereotype to the fore. Let’s not feed the buggers any more than their puny little diencephalon can handle.
I like you Gaad! You and I have much in common.
Let’s hang out and suck each other’s dicks while we light firecrackers and talk about how much we love China.
So what about the fact that 60% of African Americans grow up in single parent families? Or perhaps the statistics of drop outs/under age pregnancy that happens in the US with African Americans?
The truth of it is that I don’t hate blacks. I have very close black friends. However, we must face reality and deal with these social problems that the African American culture has.
Not saying that other ethnic groups in the US and around the world don’t have their own set of problems. It’s just different sorts of social issues from those of blacks.
The fact is the young black males of which you speak have not run off to get some other girl pregnant. They are in prison. In the united states they privatized the prison system. Those running the prisons can not make a profit unless they have criminals to put in their jails. Corruption and jailing of blacks is rampant. If someone makes a profit based on how many black asses end up in jail guess what happens next…..
http://www.cnn.com/2009/CRIME/02/23/pennsylvania.corrupt.judges/
If you are really into statistics check out the justice department figures which show black people routinely get jail time for minor crimes that whites wouldn’t even be arrested for.
ROFL.
Because having black friends suddenly makes you immune to racism.
/end sarcasm.
Get a clue. It’s not “African American culture” dipwad, it’s the effect of generations of economic, social and political dis-enfrancisement and INSTITUTIONALISED RACISM.
I will give your ignorant arse a moment to look those terms up.
Again, here you are mouthing off without backing it up. Please unfriend your black friends because you are clearly learning nothing from that which informs this discussion.
I’m with black guy below. INFORM YOURSELF and STOP LOOKING LIKE AN ASS.
“I have very close black friends” sounds like an explanation given by an undercover racist.
YOu’ve seen it happen a million times huh? you must be very old and experienced. Where do you even think up things like that. “most black guys” is it really that easy to generalize? Has a white man never left a pregnant woman to fend for herself? you associate “black” with a poor sense of responsibility. In fact, it’s a personal decision. Are you saying these men leave their partners because they are black? Does being black make you inherently likely to run away from your child? I wonder what gene determines that.
My exwife is black thats why I know so much about it. Steve McNair is a good example of this, only his girlfriend wouldn’t put up with it.
There’s a good reason, I assume, that your black ex-wife is your EX. I wouldn’t want to live with a spouse that views my race as irresponsible, unintelligent and all-around bad.
In reality, you know nothing about the black condition, in the States or elsewhere.
My ex-biatch’s name iz joe and me best homeboy’s name iz joe too. And you’re a tool too, tool.
So fucking PC in west about black. But regarding Chinese, they show no hesitation about their racism. Fucking Cowards.
Come see me. Seriously, I have no racism in me, but I also won’t accept your shitty attitude.
And I’ll just show you my love.
I want Gaad! to blow a WAD of his “love” in my tight, yellow butthole.
I want to feel all two inches of his boner in my Chinese ass!!
JIA YOU!!
you are a true 白癡
Oh please, people only show PC in public. Look on the net at youtube comments, SomethingAwful forum, and 4chan. Same type and intensity of racist comments.
This is the internet, there’s no real life negative consequence when one makes a racist remark so it’s a free-for-all. Heck read through this and other Chinasmack comment sections, half of the comments here discussing racism in China are racist.
your examples suck. youtube commenters are known for being bottom of the barrel knuckle-dragging mouth-breathers. 4chan racism is a joke. and as a goon, i know somethingaweful does not tolerate racism. i’ve seen people perma-banned for it too many times.
I will think the criticism arises due to the fault of her mother. If her mother will to marry a black when she is still single, I believe the issue on the color of her kids will not be subjected to any ugly discrimination. The moral story of the whole article is that Asian society as a whole, is not willing to change to open society as compared to the West. It has nothing to do with Chinese as rascists.
There are TONS of kids here born from EXTRA marital affairs. There are tons of extra marital affairs here, so what is the issue? Oh, that it was made obvious by her abnormally well toned skin and perfectly proportioned body?
These KDS fags can rot in hell… making ridiculous amounts of totally ignorant remarks about a situation that they don’t understand. Most of them are trying like hell to cultivate their first pube and they dare to castigate this woman and her daughter? Fuck them.
New Mission of the week, I am gonna find me a married Chinese bird and fuck her pockets empty.
Wooo! Can I please come along? Please? Please? Pretty please, with lots of cherries on top?
And I, will pay. First treats on me gentlemen.
Uggghhh!!! Some hommie simply don’t know the meaning of irony….
That’s right bro I think it’s time I went back to Africa and organise a political party that’ll kick all the chinese men out and leave their woment there to inter breed.
@ Hell — Oh please. I’m Chinese and grew up in the U.S. Except for a few schoolyard taunts, there was NO racism against me or my family. Not at school, not at finding a job, not at making friends, not at dating — nothing. My dad’s American company even paid for him to improve his English with a tutor.
Actually, I think racism is worse against blacks than Asians in America. We’re just known as being good cooks and being good at math! Asians generally fare pretty well in the U.S.
Talk to mainland Chinese though, and they are FULL of racist thoughts. Laowai are like this. Blacks are like that. Mixed-race are like this. So judgmental. Just like you.
The only “racism” I experienced was when I met a group of Chinese students at a U.S. college and they yelled at me for bringing a blonde friend to the table. They said “no foreigners can sit with us!”
So true. Mainland Chinese people are hella racist towards black people. It not they racist cuz they are just mean people, but they just don’t know any better (i.e stupid) They think they are either poor, stupid or a thug.
all of thats because you’re a girl.
you should look at US media more closely or better yet read US history at how chinese were treated
yes and look at how white americans treat black people and study the 400 years of slavery that african americans went through.
both black and chinese people have been victim to racism so why turn on black people instead of uniting against racism?!!!
“…400 years of slavery that african americans went through.”
Wait, are you saying that slavery in America is 400 years old because America isn’t even 300 years old yet.
yeah cuz racism is done by white peeps against white peeps huh shit4brains?
Simply because the Chinese were treated poorly by US Americas does NOT give the Chinese a free pass to be racist against ANYONE. Are you justifying hatred on the grounds of being hated?
Yeah, everybody has a chip on their shoulders, so what’s new?
Yeah, and our Chinese penises are only 2-inches long so of course our Chinese men have chips on the shoulders!!
School yard taunts don’t count as racism? Seems like you’ve been living with a paper bag on your head. Americans try to keep a visage of PC but it is very much there.
Mainland chinese can be racist, so can Koreans and Japanese. My black friends have told me they felt most discrimminated in Korea and how many countries have you come across that have a “no foreigners” sign allowed legally outside their stores? Japan being one of them. Comments about Laowai this, blacks that are not “racist” they’re called racial prejudice. People like that are are either ignorant or hicks who were brought up without knowing better. Racism is when you think your race is superior to another. And actually there is a conception among chinese that mixed race people are usually more intelligent…The more mixed the smarter. judgemental? yes, racism? Sometimes.
Imagine if the Chinese father accepted his biracial daughter openly. Would Chinese people be even more racist? I would admire his courage and love. But what he did was logical. Poor Lou Jing. Shame on the mother. I hope her biological father trips on a gun while robbing a gas station and gets a bullet in the gonads.
I’m bookmarking this page. Whenever I think there is hope that I can understand Chinese society, and the differences aren’t insanely vast, I will reread the Chinese comments.
Why do the differences look so vast? The Chinese racist and bigoted comments look pretty much the same as Euro/American racist bigoted comments: fear of the presumed sexual power of black men, worrying about the purity of the race, viewing black people as uncivilized or criminal… I can’t see anything here that shows a uniquely Chinese version of racism. Anyone from a European culture who thinks this is incomprehensible and alien has (a) a poor grasp of history, (b) a short memory, and (c) the good fortune not to have seen many comments on sites like youtube.
yes i agree this is not the same type of racism as the white Americans against black and hispanic people. However, this is still a different type of racism and the ignorance of these racists must be addressed. As knowledgable people we must educate those niave racists about other cultures so that these views maybe changed.
I am a black europeon of Chinese, Caribbean and south american decent. I admit there is rascism all around the world in different forms and extremities. I am lucky enough to live in a city where there are many cultures and where the goovernment do a lot to limit racism and educated the ignorant.
Please people! GO OUT AND LEARN ABOUT DIFFERENT CULTURES!
You guys are all crazy. These people aren’t racist (there’s no racism in China), they just hate black people is all.
…and a follow up for the slow: that was sarcastic.
yeahh its in blood and tea!
No, it’s in da love juice. Want me to show you mine? You’ll like it very muchy, I promise.
Gaad! is so funny and clever. His comments give me a happiness in my trousers.
Come blow your love juice in my gay, Chinese mouth but make sure you have enough for my boyfriends too!
Chinese people are indeed racist but currently, at least, nothing beats the number of white anti-miscegenation websites on the web. I took some time to browse through that circle of blogs and MAN, do they hate other races (esp. blacks and Hispanics).
how can you compare this?
I’m white and I have a ton of Spanish friends.
I don’t know a ton of black people but most of the ones I’ve met were cool.
that’s coz we r superior and rich and we invented the internet
if u dont like it dikwad , y dont u leave lol
Dave Chapelle was smart he married a filipina.
I love the Dave Chapelle sketch where he’s a blind KKK member.
lawl,
china is the most racist place i have ever been to.
that this article is passed of as NEWS, is a fkn disgrace.
keep pretending this is shocking guys.. its just normal in china.
Call me once you see a lynching in China. Until then, stop whining.
Why does it have to be a lynching?
How about someone being shot with a gun?
Did Mao Zedong say something about “political power comes from the barrell of a gun” ?
Racist? The chinese didn’t import blacks to the new world like herd animals. They didn’t break the front teeth of black slaves to force feed them liquid and keep them from suicide. The chinese didn’t exterminate the native americans in both North and South America, and practically the aboriginals in Aussie. The chinese didn’t rape, pilfer and burn the non-western world in their quest for domination and natural resources. Having built the railroads and mined for minerals, the western and aussie countries then expelled the chinese and signed chinese specific exclusion laws. If the chinese are racist, then I guess it takes one to know one.
The mother is a tramp period. What else do you call women who has an affair. The father is a lowlife scumbag. I wouldn’t have any beef with the daughter, her being born is not her fault. However, it is my beef when she uses her blackness to get notoriety. If you’re going to play that game, then don’t be surprised if you get burnt from the other side of the coin.
And all this PC black love in the western world is just the current hollywood/media fad flavor of the day. Of course, hollywood and the media runs a massive trade in racism and ignorance.
While I have no lamb chops with your first paragraph, but following on from your second paragraph, do you expect the girl to hide her face under a hoodie all her life? And how exactly do you know she is using her “blackness to get notoriety”, oh my sweetie pie?
Is the media-entertainment industry not a valid occupational choice for a black-Chinese gal or does blackness automatically equates notoriety in your mind? Dude you need to unzip your pants more often and live a little. Now go love a sista. I for one welcome her addition to the Great Chinese gene pool, oh yes…
Ah yes, respecting black people — just a fad!
Sorry to interrupt your self-righteousness, but just because China didn’t enslave black people doesn’t mean Chinese people can’t be racist. The US didn’t force thirteen year old girls into marriages for money and bind their feet until the bones cracked and bled, but does that mean only Chinese people are misogynist?
(Hint: the answer is no.)
Also, I wonder how she is “using her blackness to get notoriety”? By going on TV and revealing that she is half black?
And just because you’re an obnoxious whiteboy parasitizing China and abusing white privilege it means you can lecture more progressive people on race?
No.
LMAO.
“More progressive?”
Did you even *read* the comments directed at that girl? Ring me up once China actually progresses, k?
And just because your a self-righteous nationalist tool devoid of empathy and racial intelligence (read: not racist), does it mean you can lecture “obnoxious whiteboys parasitizing (LOL, I love how you used creative verbage on that one!) China and abusing white privilege lecturing your (noticeably less) progressive people on race?
By god, no.
Heh?! Non comprendre was der Kerl parler la. Can somebody 翻译 per favore und mucho obligato.
probably her ceing black revealed it on the television. i mean call me a rocket scientist and i didnt even watch the (s)ho
Dude, seriously. The slaves thing (as well as most of your other examples) was CENTURIES ago. We’re talking the here and now, present day.
lol. slavery in China was officialy banned first in 70′ens. together with ceremonial canibalism and human sacrifice.
Well, that sounds like progress to me.
yeah, because fads always last for 45 years. the rest of what you wrote is just more of the ever present, fenqing banality: strawmen to distract the reader from the original topic.
“Your shoe is untied.”
“Yeah?! WELL YOU’RE UGLY!”
Chinese kept slaves for centuries, just because (most of them) weren’t black doesn’t mean that China never had a tradition of slavery.
I love the fenqing who have suddenly become so interested in American slavery…I’m sure the African-American community appreciates your “leeching” of their story of struggle in order to prove that Chinese aren’t racist…
Point being, you’re an ignorant asshole.
You really have no clue how many married women are fucking someone else do you? LOADS!!! And the only difference is that this woman was getting some black rod… she was likely occasionally doing her husband (as Chinese couples tend to do I’m told) and she decided to have the kid.
Kudos to her…. how would she know what color the childs skin is.
She won the lottery. That child is gorgeous.
“Racist? The chinese didn’t import blacks to the new world like herd animals.”
No, but they did import them to China. In large numbers
http://www.sino-platonic.org/abstracts/spp122_chinese_africans.html
as for genocide, take a look at Tibet. 17% of all Tibetans killed in the last 48 years. That’s pretty impressive killin right on your own border.
But, hey you can prove anything with the facts.
Which the delightfully racist elements in China are happy to ignore. At least in the west we acknowledge racism as wrong, not hold it up as some sort of virtue.
Yeah, not to mention that blacks in America are probably better off than blacks in Africa.
Africa is in the state that it is in now because of slavery. If slavery had never happened, the continent of Africa would be more developed and many of the countries would be some of the richest in the world. But then again, many people don’t know this because they can’t think for themselves and instead accept whatever they are taught in school. Africa WAS the richest continent in the world til many of the kings and rulers were taken and families were separated. Since then, all of those countries have been playing “catch up”
Yeah! Other people made us this way!
“Africa is in the state that it is in now because of slavery.”
Evidence?
Can you site some sources?
makes u wonder y as “The number 1 power” they allowed their poor little hynies to be seprated , enslaved etc, doesnt it? o wait did some1 say low IQ?
Dear Fike2308,
Africans in Africa are not necessary better off or worse off than their American cousins. All races have good & bad points ditto all the racist comments about Lou Jing.
Unfortunately C’est La Vie.
Regards.
Bam Bam
PS I am an African Black
I wouldn’t be too self guilty about having certain stereotypes. Specifically on blacks, where do we get the stereotypes from? Hollywood and the western media, the same ones who now propagate the black love fad and evil chinese/asian stereotype.
And these “enlightened” above commenters spew the same, if not worse, hate, racism and stereotypes based on a few internet comments.
Something about a kettle name calling the teapot comes to mind.
Who taped you in front of a television and forced you to watch Hollywood movies anyway? Many of us who grew up in the US managed to grow up much less racist than these commenters, despite the fact that we’re WAY, WAY more exposed to the so-called “Western media” and Hollywood.
As for it being hypocritical for Westerners to say anything….this is PEOPLE talking to PEOPLE. I am not “The West”. I never enslaved a black person. You are not “China”. You never bound anyone’s feet (I assume). Whether or not it’s hypocritical for me (or some other commenter) to say these netizens are racist, well, you have no idea. You don’t know any of us personally. Of course, there are frequently racist comments against Chinese people made on this site so I assume some of the commenters here ARE being obviously hypocritical. But you see my point, perhaps.
In conclusion, lame excuses.
Well said ChinaGeeks, 100% agree.
Also, it’s pot calling the kettle. Not kettle calling the teapot.
Teapots are known to be all sorts of colors. Much like our world.
“Specifically on blacks, where do we get the stereotypes from? ”
My response would be that most stereotypes are based on reality.
Look at Apu in The Simpsons (one of my favorite characters).
It’s funny because where I’m from (L.A.) pretty much every 7-11 is run by people from India!
Also, the stereotype that whites can’t dance and asians can’t drive are based on reality.
How does this TV show work? Is it like American Idol, where people vote up their favorites? Because if that’s the case, it looks like she’s ranked 7th, with 1.3 million positive votes and 103 thousand negative votes.
So if this is one of those voting shows, you know, to their credit a lot of people are voting her in spite of her color. That should be mentioned.
Whaaat?! 1.3 millions positive votes and 103 THOUSANDS NEGATIVE VOTES?! There should be absolutely no negative votes whatsoever, dammit! Dang, bugger me silly and rip me a new one, us chinkies are like sooo totally racist, nooo? What does a sista have to do here to catch a break.
I think a lot of people are voting for her just because she is pretty, if you listen to her sing, she is not all that great actually.
http://ent.joy.cn/video/711709.htm
Loujing sings at the competition.
Chinese are the most racist bunch living on this planet, only care white skin, white babies, they’re no different than blacks themselves, bunch of farmers the Chinese are!!!
Dude, isn’t the sun a bit too bright for you? Surely, you must miss your hole under that rock of yours very much.
I miss the loose hole between your ass-cheeks gaad!
Now stop flaming these laowai and come flame my yellow balls!
I don’t think anyone should worry about this, a great deal of mainland Chinese people just aren’t used to this kind of multiculturism. Most of these comments probably come from people who have never even talked to a black person before.
I’d do her but I’d keep one eye on my wallet.
I could do YOU but I’ll keep BOTH my eyes closed with tiger balm on my upper lip. Better yet, give you a paper bag to cover your skanky Pusan face.
Gaad!: I’m flattered but the only man I’d ever go homo for is famous Korean singer Rain.
Giggles! You think I’m a guy? Man, I need to get your Pusan puss acquainted with me jinky-kinky collection of strap ons. Betcha u won’t feel the same about da ladies after that, or much of anything else for that matter.
All those guys, and they are certainly mostly guys, making those comments will be lucky to ever be with a girl as attractive as she is.
Fixed your post:
All those guys, and they are certainly mostly guys, making those comments will be lucky to ever be with a girl
True… you fixed it well.
Chinese are just angry their little dicks couldn’t keep a woman from going off and cheating with a black guy.
Wow! Somebody seems very familiar with Chinese men’s genitalia.
Wow, answering racism with racism. that’s really likely to work. good job. You must be really proud of your penis. Why else would you poke fun at others?
@Gaaad!
China’s first Foreign Minister, Eugene Chen, was a mixed Chinese and black (from Trinidad).
He was Sun Yat-sen personal adviser and private secretary, a position he held until Sun Yat-sen’s death in 1925.
http://politicalbiographies.suite101.com/article.cfm/return_to_the_middle_kingdom
Time Magazine, in its Dec. 11, 1933 issue, noted “the new Fukien Government has as its ‘brains’ that amazing man of South Chinese politics, Eugene Chen.”
http://www.time.com/time/magazine/article/0,9171,746478-3,00.html
Eugene Chen’s grave stone in Ba Bao Shan
(Mountain of Eight Treasures) Revolutionary Martyr Cemetery in Beijing.
http://yuantsungchen.com/new_page_6.htm
Whites are very quick to label Chinese racists when it comes to blacks yet China is far down the ladder as being an anti-black “racist” country. I believe that honor belongs to Poland, Russia, and the Ukraine.
Yes, there are Chinese who have anti-black sentiments. So what? In Africa, there are blacks with anti-Chinese sentiments. No need to discuss the anti-every(race) views in the “civilized” countries – the US, the UK, Europe, etc. Matter of fact, xenophobia is the coin of the realm.
Unless there is a higher quality of humans in the world, racism (xenophobia) will continue to exist. Until then, people just have to suck it in and fight back!
Thx for the links, much appreciated. A fascinating and mesmerising history.
Excusing your racism by citing others as racist is amazing but sadly expected from such dimwits.
As always they want it both ways. The victim chip on the shoulder complex with the west but the superior complex with others.
Is there even a racial dscrimination law in China? If there is you know it will be toothless.
!
Nope, no racial discrimination law in China (HK excepted) that I can think of. Everybody is expected to stand up for themselves so that they can stand on their own and be proud of that fact (apart from some affirmative action privileges and financial aid for “recognised” economically under-developed minorities that is). Everybody is expected to be tough as nails and if you fail, too bad, that’s the market economy for you.
Don’t try to talk about “standing up yourself” and being “tough as nails” because that’s horseshit and you know it, I know it, and so does everyone else here. I’d like to see you stand up to a mob who are filled with loathing for you because of your skin color. And market economy? I wonder what the Uighurs in Xinjiang would say to that when they see job advertisements that say “只要汉族人。”
Eh…sombody obviously missed hitting the sarcasm tree when he was just a wee apple falling off his daddy’s tree, non? Here, have some more cha. You’re choking on all ya righteous indignation and going green in da face.
Besides, are you going to let a sign put you off?
What can I say? Trends in comments tend to lead the reader astray. Besides, given the apparent surplus of bulldozing fenqing, it’s easy to see where mistakes may be made.
Well, ain’t some hommie a quick draw with da lable and name calling when it comes to disagreeable comments. Git personal is da name of da game, non?
“Da healthcare reform iz EVIL! EVIL it iz I tell y’all!”
I find that people who are full of righteous indignootions usually have a corky up an orifice somewhere, whether physically or mentally.
She’s gorgeous.
Hot Chinese girl with junk in the trunk.
ooh right.. cuz chinese girls are flat and black girls are really curvy right?? how clever
There is no truth to that? or are you just blind…
I am not making judgements either way on appearance but…
BTW…
1) there are tons of black ‘races’…
2) Chinese is a NATIONALITY… not a race
Yes, Chinese girls are usually flat and not as curvy as black women….or western women.
Tits and asses are not appreciated in the middle kingdom.
Reminds me of ya motha…
What is wrong with everyone? I think she is a beautiful mix and she must have such an interesting heritage.
Her parents are just normal people. How can you judge them without knowing anything about them? Maybe the mother’s husband was a complete arsehole.
What a topic, huh?
China is racist, like all countries. The fact that the population is overwhelmingly of one race (90% Han last time I checked) doesn’t help this fact. One big problem I have with Chinese racism is that it is considered completely acceptable by most of society. No one is going to speak up when someone makes a racist comment. For example I celebrated Spring Festival with my old host family and the dad made a joke that Obama will turn his milk black (or something like that), the family was so surprised that I, a white Anmerican, would consider that wrong. Or consider the story of a black English friend of mine who taught at a public school in Hunan. One of her students drew a picture of her as a monkey playing basketball. Naturally upset she went to the administration. What did they do? The principal laughed at the picture and refused to punish the student. While all of this is going on the government makes out China to be a place that loves people of all colors. That’s not what they’re saying on the streets.
I think a lot of Chinese consider the West (whatever that is) as racist as them, no doubt due to our horribly racist hsitory. But the fact is we take racist actions very seriously and I’m fairly certain China would too if the country wasn’t so damn homogeneous.
couldn’t agree more, what’s lacking is any form of intelligent dialogue about race, if this forum is an example there is a long way to go. i think there is more to it than just being homogeneous, education, and worldliness are still stumbling blocks for China.
lol the story with the little kid is fucked up but also kind of funny…
Homogeneous=Inbred
I agree with VeerLeft’s equation.
Yeeeee!!! What a cute lovely couple you too make!
Why are you following me around?
It seems like every time I make a post you have to hurl some random insult at me.
Very weird.
Cause you soooo angry dat you a soooo cutie! Me likesy precious!!!
The sad thing is that it is not seen to be morally wrong at all.
Next time they bleat about anti Chinese(government) bias this should be thrown back in their faces.
It reminds me of nothing more than bullies who can act big but whine like children when it comes back their way.
USA takes asian racist actions seriously?
I forgot you are white and you seem to know whats going on even though you are not asian
Well, that there destroyed my naieve notion that China is merely backwards due to being a more homogenous culture. I don’t think there is any excuse for this!
BTW, I’m in LOVE! Marry me???
Very beautiful girl. What a shame that she has to bear the brunt of such vitriol from ignorant morons.
Seriously, I was very surprised at how degrading some of the comments were. Even if her mother chose to have sex with a black man, why should they give a damn? Her mother is an adult, she made her choice and she has accepted responsibility for her actions. Who you fuck/date/marry is no one else’s business.
While I agree with all of your points – the moment you thrust yourself into the spotlight (ie. appear on national TV, or media, or whatever) you need to be ready for any and all criticisms that may come your way.
While it’s none of anyone’s business, she chose to make it everyone’s business. You can’t have fame and privacy, publicity and no criticism. They go hand-in-hand, and to think otherwise is ignorant.
That being said, I hope this blows over and, maybe…who knows…opens up some people’s eyes to the issues around racism in China, maybe for the better. Sometimes it takes people who bridge gaps by being multiracial even though they’re seen as a single race, to help build these bridges. (Asian Obamette maybe? haha..)
You are definitely right, the whole thing just feels unfair though…eh, I guess life’s not fair sometimes. :-D
While you make a point, Rick, there’s a big difference between the lack of privacy that accompanies being a public figure and a slew of racially driven criticisms.
Case in point, it’s one thing to make fun of Obama because he has big, funny ears that stick out. It’s quite another to scream “ni–” and “kill him!” at a Sarah Palin rally. Both are inexcusable and should be addressed immediately rather than throwing up your hands and saying, “well, that’s life!”
Are you serious? Know your audience. Everyone seems pretty much in agreement that racism is rampant in China. There should be absolutely no surprise that people are posting racist comments on forums and such as a result of her coming out. Again, *it would be ignorant had they not expected it*.
I never excused it. I simply said it would be ignorant for them to have not expected this backlash. In fact, I think it will end up being very good for her – career wise. If nobody said shit, she’d just be another one of a million.
right. i hope she is not like britney spears..
I saw that show, and the TV presenter had the girl in tears, cos she kept asking about her absent father, where he was from and why he ran away. Just by coincidence (not), there was another Chinese-African kid on a the same show a few days later, and again they were playing up his blackness (he was doing Michael Jackson imitations). This kid’s African father was not openly refered to, but I was waiting for the presenters to start milking his story for all it was worth too.
I agree with the Chinese commenters on some areas here. This was similar to the outrage whites had when they saw a mixed black/white couple in the 1950’s in the U.S. Gradually they relaxed there standards now you have tens of thousands of bastards born to white women eveyr year when their black boyfriend runs away. Often the grandparents end of raising them but this social experiment never works. They still end up dropping out of school or end up in prison. 90% of black Children are born without a father married to the mother. Not to mention the violence in their community.This is in the gene code, look at Hati, any country in Africa, parts of major American cities, etc… you only find destruction, violence, and poverty.
It’s amusing how many people from Mississippi and China share the same views, yet are raised a world away. I don’t know which of these you are more likely to be – neither have a reputation for grammar/spelling or tolerance.
Have you been to Ha(i)ti? Any parts of Africa? In fact, people I’ve met in Tanzania happen to be amongst the least violent or aggressive I’ve met, anywhere.
Rick the Prick- How did you know I was from Mississippi?Interesting how you don’t mind sterotyping Southern whites or Chinese but god forbid someone speak the truth about your precious black people. Hope you can stop teaching English for a second to read this post you loser. Go find a real job. You all show your lack of education and itellectual horsepower with your reply. I talk about statistics…you all start with …well I know this guy or such and such. You clearly are brain dead and don’t understand anything about population distribution. On average, Chinese are are shorter than westerners…no there not, Yao Ming is 7″6. You do have one point, East African’s are less violent than West Africans. By the way, can you find one city in the world with a black majority that is not a violent , desperate, hell hole? Didn’t think so. Ever check the FBI crime stats in the U.S.? Ever think for yourself? Go back to your fantasy now…class will be starting..
“On average, Chinese are are shorter than westerners…no there not, Yao Ming is 7″6.” – ChinaJim
Um, do you know what the word AVERAGE means?!?!
Yao Ming is NOT your average Chinese person!
Based on my experiences in China, Western people, on average, are taller than Chinese people.
Yao Ming is an exception to the rule, not the rule itself.
I hate mindless insults like:
Go find a real job.
Get a life!
Your momma!
Etc.
U seem very good at it.
Can you show me where I have used any of those insults?
Also, why are you stalking me? It’s like you’re obsessed with me.
GAaaaahahahahaha.
1. I’m not a teacher. In fact, there’s a very small likelihood you are nearly as successful as I am, speaking on averages.
2. I didn’t say all people from Mississippi or China behave like that, but “many” in terms of how they are perceived, do, hence the ‘joke’. I’ve not been to Mississippi, nor do I know anyone from there, so I can’t seriously claim to know shit about them.
3. You claim I am the one who is “lacking education”, lets see:
a. “itellectual horsepower” (int)
b. “no there not, Yao Ming is 7″6″ (they’re) + (7′6″)
c. “East African’s are less violent than West Africans” (Africans), + You don’t know shit about Africa, moron, Somalia & Sudan? It’s not separated east/west=violent/nonviolent. Stop talking about shit you know absolutely nothing about.
d. “Can you find one city in the world with a black majority that is not a violent, desperate, hell hole?” Accra. Wait, you wont know where that is; it’s in Ghana. Look it up. Wait.. Ghana, Ghana is a country in West Africa which borders the ivory coast (go figure).
Rick the Prick-
Thanks for correcting my grammer Mr. Succesful. Let me guess, your CEO of an trading company? haha
Let me know when you actually sell something.
I drive a BWM 7. Now go get your scooter.
By focusing on typo’s you deflect the real arguments.
By saying W.Africans are more violent than E.Africans does not mean E.African’s are not volent. My God dude, you have no critical thinking skills at all.
I reccomend you study some basic Greek Logic.
Face it dude, you live in a fantasy world. Did you notice I argue against your statements, where as because I do not share your viewpoint I am somehow “un-educated”.
Your the programmed one, not me. Go back to your Matrix Pod.
Regarding Ghana, Ya, great place. Ghana has a high HIV infection rate,extreme violence to women and most of the population lives on a dollar a day.
You called me uneducated, Jim. Then you went on to rant…a rant riddled with many language mistakes – that’s the irony, Jim, which you exhibit very clearly for all to see.
I’m not even going to address the rest of your ridiculousness, it’s not worth my time.
ChinaJim is an a#$h%le.
1.Ghana has the about the lowest HIVr rate in Africa.
2. No woman is discriminated against here (except Jim’s mother who came here and was running a brothel serviced by Chinese girls after seizing their passports.
3. West Arica has only the black sheeps of Liberia (now calm) and Sierra Leone (serene).
Jim get a tutor and I hope u regret cheating in your history lessons in grade school. You know?, dont make a comment about something you dont kow shit about. it only makes you look STUPID. If u had kept your mouth close, we’l have thought you wise.
Mmmm, I love the taste of ignorance in the morning. I like it bitter just like my coffee!
ACTUALLY, there are many prosperous African nations, let alone cities. Please educate yourself before commenting on the state of a continent which you know ABSOLUTELY NOTHING ABOUT?
Right then. Feel free to return to your poorly-informed worldview now.
Aaah. The master geneticist as spoken. He’s found the gene for parental absenteism that only manifests itself in black males throughout the world. The may be spread throughout the world but their genes are all the same. what a revelation from a truly enlightned mind. I especially like that statistic. I’ve met countless young black indivduals in my lifetime and the only one who did not have a father had lsot him to the warfront. I guess I was really lucky to always fall in the 90% right? I’m really interested to know where you got that statistic Chinajim. Did you also come up with a name for that gene you discovered?
Here you go A.
I stand corrected…It’s not 90%…it’s only 70% of black children born out of wedlock.
http://www.npr.org/templates/story/story.php?storyId=4865449
The DNA gene code you asked about is as follows: ATCGCGATGTTACGCHIMPATTCGCGAGACGACCGATTAT
Very witty to throw a “chimp” in your pseudo-code.
You’re not worth the time to argue with. Just another ridiculous bigot.
haha- opps, that was a typo. Here is one you won’t figure out.
I meant to type…..ACTGGGCATTAGAATTCGATOMOHASIKCIRAATTCCGGATCG
Genius.
You’re also anti-gay, then, ya?
Out-of-wedlock births are also rising in much of the industrialized world: in Iceland, 66 percent of children are born to unmarried mothers; in Sweden, the share is 55 percent.
http://www.nytimes.com/2009/05/13/health/13mothers.html
Let’s pretend that you are NOT an idiot….(for the sake of argument)
By your logic the genetically submissive yet devious mother cheated on her genetically inferior and under-endowed husband… with the genetically masculine and genetically irresponsible black american…
How should this reflect on the Genetically diverse and physically pleasing child?
Oh wait…. the commenters are GENETICALLY STUPID AND GENETICALLY incapable of empathy. Well thats inbreeding for ya…GENETICALLY speaking.
ChinaJim welcome in Tanzania, stop talking bullshit you not sure of ”HAKUNA MATATA”
Yeeeeh!And everyone knows that China is a marvelous lands with lots of happy beautiful people, national health insurance and pink poneys.
You know Africa so well and I guess you can tell violence is in gene code because you got Ph.D. in Molecular Biology
Wow, I guess most of these farmers have never left the country and don’t know anything besides their own culture.
Ironically cheating seems to be part of this culture – or which Chinese man goes to KTV only for singing? What about all the pink lighted massage parlors? Only for singles? What about the second wife phenomenon?
This debate shows once again the double standards in China.
I don’t think this is a case of double standard. Ask these netizens how they feel about officials with second wives and they’ll give you the same response. Where the double standard might exist is what they do with their own lives as they get older. Young people are often self-righteous. But as they become adults and enter into that corrupt, cynical, dog-eat-dog world, their views begin to change.
It’s called hypocrisy – and it’s not limited to China. Look at all the republicans in the US being busted right now for preaching about family values, yet caught with their mistresses? How about the priest who faked his own kidnapping so he could spend more time with his mistress? This is definitely not a China-only circumstance, it’s a human circumstance that happens everywhere from developed, developing, and undeveloped nations – I’m sure the Korowai cheat sometimes too, the difference is the result is the cheating husband/wife ends up as his/her family’s next meal.
I agree. However…
I think they will NOT give the same response. It will be, “Oh, those officials suck, because they had second wives.” It will not be an attack on their children s or wife’s race.
The problem is not with what people say, but what people do. People say one thing and do another. It is hypocritical and annoying. So many pink houses and a lot cheating exists in China… A place where prostitution is illegal.
Also, I don’t agree with the older example you gave. Having experience in education, I can say a LOT of middle school students in China are sexually active. The parents are clueless. Bad behavior starts young and matures as people get older. Same thing happens to good behavior. No one just grows up and do indecent things because society is that way. They learn these things from an early age and it just matures. That doesn’t mean society can’t influence them. But, at their core people’s identities are composed of nature and nurture.
The self righteous problem doesn’t only affect the young. I noticed that many “adults” are also self righteous as well. Just not many people can back up the righteousness. So we live in a society where these same self righteous adults, create young self righteous children. The circle restarts over and over. But, no body just comes out and faces things directly.
As for this case of cheating, I don’t know if I can say her mother was right or wrong. I simply don’t have enough details AND I don’t care, because it’s none of my business.
So what’s your solution?
Solution: Be the best person you can be, and try your best to obey the rules of your society, or choose to leave your society if its rules don’t agree with yours.
Hello!
Well, I just want to say. She is hot and I would probably tap it. Ok, Definetly…
I think there are a few issues that I haven’t seen addressed. 1. WHY IS IT ANYONE’S F*CKIN BUSINESS WHAT HER MOTHER DID? Anytime a chinese person goes on these shows, they don’t do a back ground check! Now, because she’s black, they MUST make sure her history is justifiable for the Chinese audience. Are we in America? (The oh, lets check the black guy and make sure he is not a gangster mentality, is not wide spread in the U.S., but it happens. F*CK!) At least, in the states someone can sue for this kind of sh!t!!!!!!!
Also, how can people pretend the know the whole story of the affair. Maybe, her husband was a lying sack of crap and she felt lonely. Maybe, the guy she had an affair with didn’t know she was pregnant. It’s all so upsetting to see another case of Chinese unable to mind their own business. But, the big question is…. What does this have to do with this innocent girl? She was not involved in her mother’s affair and at least I respect her mother for taking care of her.
The next problem, I noticed in China is the point the finger philosophy. It happens way too much here. Its not everyone, but its enough to piss me the hell off!!! In China, how many people cheat? All of my friends have been cheated on. Men and Women. To be honest, not all of them were angels. They cheated too. But, when someone that is black, goes on tv…. It’s like, lets hate the monkeys. Truly upsetting…
Don’t look outward, without looking inward.
Yes, I know that there are many Chinese that are not racist. However, I will say that A LOT of mainland Chinese dislike OR are completely ignorant about black people. I know a lot of people that refuse to hire black people. Shenzhen and Guangzhou has some issues like this. Some of them, don’t even check there qualifications. The funny thing is I am good friends with a lot a black people and they get along with Chinese well.
Some Chinese also use the examples of Nigerians near the coastal cities, committing crimes as an excuse to justify their racism. I know for sure that every foreigner cannot do business without a Chinese helping them in some way. So, if someone in China is getting away with illegal activities, im sure they have some guanxi with local Chinese. Especially, when the penalties for drug trafficking is so high. So, you can’t blame all black people for the co-operation of some foreign idiots with local idiots.
Im not surprised to hear about this. I think as China develops even more. A lot of truth will come out. Especially, matters regarding race…
IM VERY GLAD CHINESE PEOPLE ARE TARGETS OF RACISM AND PERSONAL ATTACKS WORLD WIDE….
THE chinese people who travel only hangout with chinese people unlike Japanese korean etc.
The Chinese people who are stuck in China for good, ARE JUST CONFUSED ON LIFE.
PS. That girls body looks HOT
Ah yes. it’s really fair to wish to perpetuate racism on the whole of China because some people in China are racist. that will really help clear the world of all racism.
Are you serious? At my university, that’s common with the Chinese, Japanese and Koreans. They hang out with each other all day and speak their native language, but stutter making basic English conversation, but that’s another topic.
She’s a beautiful girl, her skin colour shouldn’t matter. You Chinese are just petty minded racists, would it be such a problem if her father wasn’t black?
I’ve learned to accept Chinese racism for what it is. In 3 years in Shenyang I’ve heard many appalling comments from Chinese people about other races, but there was almost one underlying similarity: None of them said the comments with hate.
In my experience, those people did not hate, and hate is what makes racism bad. Discrimination isn’t always bad, and is a necessary part of living. There is no way to deny that people are different. Chinese who make racist comments are simply regurgitating opinions that have been formed by living in a single-race society. They have little hate in their hearts for these other races most of the time. The other times, their stereotypes have been reinforced by one or two personal experiences that had been negative and were never offset by positive experiences.
For example, if someone tells you that red=1 and green=2, and all your life you had never seen red nor green, then finally one day you see one instance where red=1, you will be inclined to believe that first of all it is true, and second of all you will make the jump to the conclusion that green must equal 2 as well.
Chinese people that I know that have been exposed to many more personal experiences regarding different races are not racist and do not make such comments. These comments are born from inexperience.
From the dictionary:
racism /ˈreɪsɪzəm/ Show Spelled Pronunciation [rey-siz-uhm]
–noun 1. a belief or doctrine that inherent differences among the various human races determine cultural or individual achievement, usually involving the idea that one’s own race is superior and has the right to rule others.
2. a policy, system of government, etc., based upon or fostering such a doctrine; discrimination.
3. hatred or intolerance of another race or other races.
http://dictionary.reference.com/browse/racism
Racism fosters hatred. In some ways it is a form of hatred, because it implys inferiority. Hatred can also be ignorant. When someone realizes the stupidity of their hatred, they will change. Usually, because they realize how ignorant they were.
I have done somethings im not proud of. But, I cannot make an excuse for them. I have even hated. Illogically and ignorantly. I wasn’t even aware I was hating. So, im glad I took the time to educate myself. Others should too.
I totally agree with you. Acceptance of other customs, races, religions, cultures, etc., comes from a willingness to learn the beliefs of each. Those who cannot accept how others are different from them are destined to be isolated from the rest of humanity for the near future at the very least. Humanity’s strength lies in its resilience and adaptability, and racism directly attacks that strength by assuming that one part of humanity is better than another. This, according to Charles Darwin, is true. It was not, however, based on race, but on adaptability. Those who can adapt, will survive. Those who cannot, will die.
Are you suggesting China should adapt to the world or LouJing should adapt to the racism?
why is whatever guy taking over my name???
I’d fuck her. Well horny. Bet she has nice perky dark nips.
Laugh at all the stupid racist Chinese blogging like crazy and all actually acting themselves like a bunch of monkey niggers. Fuck off you racist pigs. Chinese people are more like monkeys than black people are. Ooophhhh Ooophhh Ooppphhh just keep spitting on the street you gob-shite slit eyed chinky monkey niggers. The world was better off when China was closed. Now fuck off back into Communism you nasty fucks. You’ve got to be dumb and stupid to allow the Commies to rule you. Black cocks rule weeny yellow tiny Chinky penis anyday.
Well said, if only those racist Chinese pigs (or is it monkeys?) are as open minded as you, the world would be better off.
Congratulations on your black cock, fantastic job, here is your prize:
//\
V \
\ \_
\,’.`-.
|\ `. `.
( \ `. `-. _,.-:\
\ \ `. `-._ __..–’ ,-’;/
\ `. `-. `-..___..—’ _.–’ ,’/
`. `. `-._ __..–’ ,’ /
`. `-_ “–..” _.-’ ,’
`-_ `-.___ __,–’ ,’
`-.__ `—-”"” __.-’
`–..____..–’
.//\
.V \
. \ \_
. \,’.`-.
. |\ `. `.
. ( \ `. `-. _,.-:\
. \ \ `. `-._ __..–’ ,-’;/
. \ `. `-. `-..___..—’ _.–’ ,’/
. `. `. `-._ __..–’ ,’ /
. `. `-_ “–..” _.-’ ,’
. `-_ `-.___ __,–’ ,’
. `-.__ `—-”"” __.-’
. `–..____..–’
Nigger cocks with tumors, AIDS deformities, 2 pounds of shit, genital warts and crawling with crabs.. rules the eight circle of hell, maybe.
Niggers are a bunch of filthy, retarded chimps. I hope more niggers die of AIDS.
quitting saying bad things about the mother and the daughter. Give a little love to them, shut your mouths,and mind your own business. Okay, don’t be nasty to them. They need help and understanding.
First of all, this girl is beautiful and proves once more that mix race gives the best results.
Her mother and herself must have lived difficult moments in such a mono cultural country…
About chinese racist comments…well not a big deal : don’t expect tolerance and smartness from narrow-minded people who have certainly never seen, never talked to a non-chinese.
It’s always the same story : fear + ignorance + cliché = racism
So…Lou Jing, Keep it up…racists either open your eyes/mind or get lost.
Peace
She’s definitely one of the hottest chinese women I’ve ever seen.
She’s beautiful. I hope she has the emotional strength to weather this storm.
I read a story once where all the people in the world were approximately the same color of tan because they’d mixed races to the point where there were no discernible races anymore. Wonder how long that would actually take….
Humanity will always find a way to segregate.
Seriously….if we were all white people would segregate on height, eye color, etc.
There is a perfect example of that which already happened in Rwanda. That’s why there was a civil war/genocide.
The Belgiums separated a once-single tribe of people into 2 tribes, Hutu and Tootsis, based only on their skin tone (light/darker) and height. We all know the results.
Belgiums should be Belgians.
Whatever.
Holy Shit is Rick Stupid.
This guy is so brainwashed. Here he is again slagging off “Belgums”. Try getting your history from some other source than a movie dipshit.
The million plus dead in Rwanada had nothing to do with whites. You libs treat Blacks like they are children, they can’t possibly kill each other without whitey causing it. The Hutu’s are a Bantu people and the Tutsui’s are a East African people hence they do look very different and have different mental capabilities. These are ethnic subgroups, people are not all the same just because there skin looks black to you. Once again I will tell you…PICK UP A BOOK ONCE IN A WHILE.
ChinaJink needs to looky at da role of da Frenchies during da Rwandan Genocide more closey me thinks.
PICK UP A BOOK BOOK ONCE IN A WHILE (me likes shouty too)
Isn’t the “go read a book” insult kind of getting old?
Not for Fike it ain’t.
Actually, I don’t go around insulting random people and using tired cliches like “Go read a book”.
It seems like a naive assumption that just because something is in a book it is uncontestably true.
Compare Chinese and Japanese history textbooks concerning WW2 for instance.
Oh, now I get it.
My “Isn’t the “go read a book” insult kind of getting old?” comment offended Gaad! so now he/she has to look up every post I make and hurl some random insult at me.
Well, I hope you get bored of me soon Gaad and start pestering someone else.
No, not that. Saw you other day walking. Your ass very cutesy. Me like riding.
Typically Chinese .. !!
I think she is stunningly beautiful!
She is BEAUTIFUL and at the end of the day fully CHINESE!
you fucking retard.
she is not. her father is what, american?
that makes her half chinese, half american.
shut the fuck up with your fucking nationalist attitude you dumb shit.
Well I accept her as fully Chinese as many more do too seems like and is she not also a Chinese citizen?
Besides, Obama is half white and everybody, including his black brothas and sistas, call him the first black US president. Why’s dat?
My eyes hurt from reading the translated Chinese commentary.
People’s attitudes towards the mother are almost as lamentable. What ‘mistake’ did she make?
Wow, see all kinds of emotions stirred up here, so it’s an eye for an eye then, Western hypocrisy and racism meemt their chinese counterparts.
Basicly, Chinese Fenqings say a lot of stupid things, their comment to Lou JING is only a small part. But they are a minority group of the society, and their name in chinese, Shit Youth, says much.
Most of the Chinese are not hateful on races, they are just ignorant on races, as China is what it is, a country of one race. Interestingly, China was not always a country of one race, it become one because of culture assimilation and inter-racial marriges going on thousands of years.
Race centrism is especially interesting here in Shenyang. Shenyang was never really part of China until the Qing Dynasty, but they still claim the entire history as their own here. I recently asked the question whether or not my wife’s grandfather was in fact born in China, and was met with surprise. He was born in Manchuria, which was not part of China, but people here tend to forget that. The Han people tend to forget that their race has continually assimilated other peoples over the centuries, and that Chinese does not mean Han.
I asked some Chinese youths if I would be Chinese if I had a Chinese hukou and passport, and they said, “Of course not.”
I then asked why. They said that I don’t “Look Chinese.” So I asked whether XinJiang Muslims looked “Chinese”. They said no. But then they said that they were still part of China. They said that this was because the Han people were, “Very accepting of the other races allowed to be in China”.
I won’t be surprised when those “Other races” rebel.
Actually, I think you need to looky more closely at the history between Manchuria and Zhong Yuan (中原). It didn’t begin simply because of or at the time of the Qing Manchurian conquest. Da history goes back many a long time ago.
Dey are like when da Roman Empire had black Caesars or da Egyptians had black Pharaohs, but which da sneaky bugger white colonialists conveniently forgeta mention for da lasta hundred years or so.
I once made the mistake of referring to Ghenghis Khan as a Mongolian. Be careful with that one.
Shenyang stand up!
A real, real shame that that disgusting scum whore of a mother is actually still alive. She should be cut into pieces alive.
true that. kill all those who dislike smelly chinks!
spitting on the street and having small dicks rules supreme!
Chinese people are incapable of responsibility on all levels, they lack morals, ethics and a soul. No wonder they don’t fit in when they move abroad and end up living in Chinatowns where they exploit each other in sweatshops or threaten each other into slave labor.
Google chinese morecambe bay
I’m sure you’re just full of morals, ethics and a soul ain’t ya. And if you’re in China, I wonder what you’re doing here?
Part of the “Ugliness” of America is its promiscuity and sexual practices They are well known and despised in the greater part of the world. America has been propagandized to accept much that the rest of the world considers repulsive, much that discourages many religious leaders, much that invites the label,”The New Babylon” for America! Notice, the jews and their ‘race restricted’ breeding practices, the pure blood French Canadians and their racially slanted, linguistically slanted, breeding rites, the Moslem’s sects who prefer interbreeding to racial mixing, Most Asians do not like “hairy monkey’ whites or Negroes for mates, the end result simply does not fit their social norms at home! It is human nature to stick to your own kind, social level, economic and educational background. Familiarity of custom makes for longer term compatibilities! Much of the U.S. male black population, statistically speaking spend time in prison, have multiple female relationships and large disconnected families – Some white guys do this too, but can hide it more easily! A brown woman will likely have a brown child that fits her social milieu, not so a white woman with black child, she is the object of rejection and derision on both sides, black and white! America will have its promiscuity as long as soldiers are needed, and that will be fore a long time, and the Chinese will reject anamalies of race as long as they have population problems to begin with, and much of the world will go on as the Jews have for Centuries, controlling their own, and promiscuous and irresponsible towards goyem, or others! Humanity has races due to this propensity in the first place!
What does America have to do with this?
I’m impressed… I assumed the KKK couldn’t even operate computers let alone type a complete paragraph. Good job Uncle B(funny your name rhymes with cunt in Chinese, coincidence? I think not)!
Black American Dick = 12 inches
Chinky Yellow Dick = 3 inches
Chinese Pussy is tight, black spunk inside Chinky womb.
Yo Mama make beautiful baby.
Conclusion: Chinese need more genetic material from blacks and whites in them, people always say mixed blood are more beautiful/clever. Its well known FACT.
Chinese people are only really 50% evolutionary completed. They need other race to weed out their bad retarded genes.
100% Chinese is obviously not a higher level of homo sapien. The pictures of the girl prove it. Mixed Chinese / Black and she is fucking hot, smart and very very cool.
Her mama knew exactly what she was doing when she wanted some negro juice in her. Clever woman. Respect.
You give respect to a woman for cheating on her husband?
He’s 3 inch yellow dick was clearly too small!
The irony, is that there are more Chinese man marry to African woman then the other way around.
What an irony hu?
NO, NO, NO! He just repects his motha very much, for obvious reasons of course.
How do you know? Did you go and inspect a lot of Chinese dicks here in China? I bet you got a really good and up close look and perhaps sucked a few of them?
“There are blacks and there are niggers. The niggers have got to go.” – Chris Rock
Remember, people in any country, who sit in front of computers all day and night, living in their artificial worlds of digital farms and virtual combat, commenting on the inanity of other places they’ve never been to, and never will, should probably be ignored… I guess that includes me.
For a black person, her singing sucks. So I guess that part is the Chinese in her.
I think Chinese people generally just need to start intermarrying with other races more so the country would start becoming more laid back. For example if you got a Chinese person to have children with a Mexican or some other type of Latino person, you’re gonna get some Filipino kids. Filipinos are the coolest and most laid back people on the earth.
I know of some other Black-Chinese/ Chinese-black people back in the states. The black traits are generally more dominant. The worst that happens with that mixture is that you get these nerdy otaku black people.
The white-chinese mixes are really common. I know a lot of those types of people too. They tend to just look and act more like white people. This world doesn’t need anymore of white people.
I know of a few Chinese-Middle Eastern/Arabic people. Basicaly, what you get with that are more Uighurs/Central ASians. I’ve met quite a few of those krygyzstan, kazakhstan, uzbekistan guys and they all seem pretty cool. Only problem is probably their religion.
If you start mixing Chinese people with Mongolians you get Koreans. If you mix Chinese people with Koreans you get Japanese people. If you mix Chinese people with Japanese you get Taiwanese people….I think you get the picture. The world will just be better with more interbreeding.
Oh yeah, a Chinese person and a Jew = super cheap. I guess you can look at it another way and say that this mixture can give you a person that’s really good with money.
Hhu?! And which pimp made you?
funny! lol.
how about a norwegian with a black father and Afghan mother interbred with a german woman of Indonesian and Aborigine descent?
That gives you a Malaysian.
Pimp war is funny….and right.
I love Fillipinos.
roflmao><
the jews is here its called hong kong
Although I’m not condoning her mother’s action, this racism against blacks just go to show you that so many in China are WHITEWASHED by the stupid white/Jews/Hollywood people to believing that “White is right”.
Wow! A Chinese KKK? Arrrrgh da KKK are spreaaading!
The alliance of Chinese and Jews is bound to happen sooner or later because of their love for money.
We should respect each individual, such taunting are unwarranted.
Fight racism! Fight racism!
wow the commentary on the racist commentaries is … racist. I love the human race :) not.
i hate chinese people
i don’t hate black people
this chick is hotter than 99% of chinese beasts
and yes, at least in the US, black people are much more highly regarded. most people hate chinese and assume (usually correctly) that they don’t speak english or have any desire to assimilate
I hate you. just you, regardless of your race. You have a low standing in my eyes because of the way you judge others.
@ Brzr: If you hate Chinese people so much, stop hanging around websites that are all about Chinese people. Stick to the websites with naked pictures of your sister.
What?!?! Where in the US are you from? Some black ass ghetto neighborhood in the Bronx?
Face it, you hate Chinese because you’re envious of what they have. The average Chinese family VS the average Black family in the US isn’t even close in comparison when it comes to money and family values. Chinese are higher educated where as a black guy even getting into a decent college not based on an athletic scholarship is rare.
The only successful blacks in the US as a whole are musicians and athletes or aka entertainers. That’s all famous/successful blacks are in the US . . . ENTERTAINERS. What a joke. Everytime anyone says anything negative about blacks in America, blacks start playing the race card and gets everyone to back off. Nothing respectable about it at all. Go listen to the Obama NAACP speech and even he says that blacks in the US are a problem.
Assimilate? What have blacks been doing the last hundred years or so? Ebonics, the N word, clothes, style, whigger, etc. Blacks in America are the ones that don’t assimilate and are proud doing it.
You are a moron and have no idea what you’re talking about.
I’m not sure you know what you’re talking about. Concentrated slavery efforts decimated large portions of African civilization and forced black people to spend centuries beneath everyone else. The abolition of slavery did not free black people from the sentiments people held toward slaves. They’d been treated as less-than-human so that slave owners could justify their actions to themselves and to others, and this view has persisted to their children, grandchildren, and so on. The end result is that white people have a vested interest in keeping black people down; the vague notion that they are securing the future for their progeny. This has manifested itself in many ways; including poor funding for areas where black people or other minorities live, racial police profiling that nets more black offenders and harsher sentences doled out to black prisoners, and racist hiring policies in higher paying jobs. If there is a surplus of black entertainers, it is because that is, historically, a job white people are comfortable seeing black people hold.
Fortunately, these tendencies ease a little with every generation, and we see more black people doing well and finding opportunity. You are sad and racist if you think that there is some genetic predisposition that causes black people to want to live in shitty conditions.
This is interesting. Why would any Black person be envious or jealous of someone Chinese. This pathetic tiny mindset just proves how childish and immature many Chinese people are.
First of all let me address, we do assimilate, but there is one thing, you probably don’t know or not educated enough to understand. Do we have to assimilate to the way Whites want? Does that mean the US is the land of Whites and therefore, we have to act and do as they say, otherwise we are the ones that are going against the flow?
America is a multi-cultural, multi-ethnic nation, therefore we have the right to have our own style and culture. Why is that Asians always want to kiss up to Whites, forget their own culture and act like them, try so hard to forget where they come from and try to adopt a banana OC type, “please accept me, I am trying so hard to be like you.” Blacks used to be like that until the 60’s and we got tired of trying to emulate Whites and learned how to embrace our beautiful culture. I think that is the underlying problem with many Whites is that we do often go in an opposite direction or being a rebel if you like. Because for the last 300+ years, we have been acting and assimilating “White America.” Now it is time for us to be Americans, NOT White Americans. There is no such thing!
And it doesn’t matter where a person achieves success or what field as long as they or not breaking the law. Being an entertainer is not a joke or are you jealous that you don’t have the talent of a Kobe Bryant or a Russel Simmons? Or is that you just despise Blacks so much, that when you see a financially successful Blacks, it just burns you?
No one is saying there isn’t a problem in the Black community, but before you run your mouth, understand the reasons, the history as to how that became, how it evolved. So if you don’t understand what Obama said why he said or if you don’t have never lived in a Black community, then you need to take yourself out of the argument.
Asians are strangers to playing the race card, so let’s not go there. I think guys like you are jealous because perhaps some brother got the girl that you wanted and he was very suave and cool, but you just couldn’t compete. Or some brother making more cash or being taller than you, hence, the childish outburst and hostility.
Hmmm…not sure which part of the U.S. you’re from. I also hope my grammar isn’t too difficult for you to understand because according to your assumption, I don’t speak English.
the brotha hit it and then quit it! props! we dont love them ho’s, beechez aint shiet but hoz & trix!!! take that take that take that…
Haha good brzr. I don’t care what other people think, especially if it’s stupid.
You just want to stir hatred in me or whatever in order to make yourself feel good and forget that you are probably stuck in China. Or maybe you are just lonely. I feel for you racists.
If it makes you all feel better murder me?
If someone hurries up and slits that throat of hers before she uses that diseased womb of hers, along with that piece of trash she calls a mother, this will all be over, nice and clean.
the difference between China and the US is simply that the US is better when it comes to multiculturlism as they have more diversity and thus bettern oppurtinitines for people to learn to become less ignorant, about other people.
We’re all people.
I HOPE the Chinese media use this to promote more understanding in order to lessening the stupid ignorance. They better. If they don’t, I’m calling in the alien overlords.
I fucking don’t understand why people do this. It’s so illogical, to live in ignorance. Look at this thread, back and forth ignorance. Chinese defending racism with accusation of racism; the hatred and blaming of Jews, so typical. FUCK I HATE LIFE.
you know why? most black people in China are into drug dealing and illegal forex exchange, and that’s how chinese people stereotype them as, it’s like one bad apple makes all the apple go bad.
True. If you ever get a chance, go to Beijing’s SanLiTuen and you can smell the stench of marijuana from the bar streets. Inside, majority are African or African Americans.
Go to the right place in the U.S. and every Chinese person there would be the worst kind of uneducated, uncooth Chinese person too. If you pick and choose, you see what you want. Also, it’s a bar street, everyone there is there for a drug, whether it’s alcohol, tobacco, or herb, you ignorant hypcritical moron.
US media is so racist free?
have you seen how asians are portrayed in US media?
You know, the fact that somebody else is stupid is no excuse for you being stupid as well.
There’s racism in every single corner of the world. There’s no doubt about it. I seriously doubt that any one country is more racist than the next.
Look at Europe. Eastern European politicans are getting into office preaching hate. UK has problems with Arabs/Pakistanis amongst other things, that’s well documented. The French won’t respect Muslim women wearing veils. (Considering making it illegal.)
Africa . . . don’t really need to mention it. It’s VERY well documented . . .
Americas, the US leads the world as far as tolerance goes, but there’s still shit load of racism that exists. Obama winning Presidency and members of racist groups multiply like crazy. And historically speaking, the US might of been the worst. Wiping out Native Americans and around 1920s had I think 9 million members in the Ku Klux Klan.
S. America is just as bad as Africa.
Asia . . . everyone hates each other, with the Japanese being the most hated by its neighbors.
Racism is everywhere. However, we must realize that most people in the world are good neutral people. They go to work, come home, eat, sleep, shit and that’s their life.
It’s the low life hicks of the world that stand out and embarass the shit out of their homeland.
FUCK HICK ALL AROUND THE WORLD
Using racism to combat racism? Wow… some of these posts are very similar to the ones on the Chinese BBS… Be aware that the internet is full of hateful, bile filled posts.
The true scandal here is that the fucking TV host on a Talent show asks her about her dad, instead of about her career aspirations or such.
Institutionally supported racism.
Wow guy . . . your reading comprehension astounds me. Please go to your local book store and buy yourself a few decent english literature books so that you may enlighten yourself in the ways of the educated.
Has anyone of you entertained the thought that perhaps the TV show asked about her history so that the viewers can understand why she’s “black” and yet “Chinese”.
Trust me on this one, I’ve met some dumb ass Chinese people in China where they’ll only judge on appearances and try as they may, they won’t understand why/how I can speak Chinese/English/Japanese.
It’s quite astounding.
Not you J. Wasn’t meant to be a reply to you. Just hit the wrong highlighted text. Sorry.
Come to the U.S! You will be treated as the amazing beauty that you are!! I am a former fashion model who has worked in New York and LA. Women like you are exotic, and celebrated!
The comments from the select small-minded Chinese are no better than that actions of Adolf Hitler. There IS NO superior race! Our world is only as good as all of God’s creations (and Buddha if you believe). He only creates perfection, and that is personified in Lou Jing!
A black skin is just against Chinas (and its subcultures Japan, Korea & Vietnam) traditional view of female beauty. It has nothing to do with racism. Many chinese girls and women even don’t like sunlight and wear an umbrella against it.
White/pale skin is just the best looking.
Racism is hard to combat in a country where everyone has the same skin color. Most of those people have never met or even seen a black person in real life. Whenever Chinese people, even in the US, say “american” they mean white people and when they talk about black americans, they say “black people”. It’s infuriating and sadly something that will take a while to correct. We can start by not putting only white people on a pedestal.
Having said all that, Lou Jing is soooooooooooooooooo pretty. I wish she would comes to the states. We know how to appreciate that kind of beauty here. :)
Chinasmack: Racism? Sex? Idolatry? I’m there!
Haha sorry, I meant adultery. Too much pagan heavy metal.
Wow, you guys are unbelievably racist. From this I can see that China is truly not ready to join the world.
Who cares what colour ones skin is??? Seriously, you guys are being an embarrassment to China, making all Chinese look as if they’re from the 14th century.
I know this is not true, so please do not act as if it is!!
And another thing, if you really are stuck in the 14th century in your mind, have the intelligence to keep your thoughts to yourself!!
Privately, you can continue to be racist, but publicly, for China’s sake, pretend to be modern!!
if i am a racist for against immigration to china or black men going to china committing adultery and leaving bastard babies then let me fucking be a racist.
ha, even as hundreds of citizens are committing adultery at this very moment, suddenly you’re against adultery…
if it is a black person, right?
good luck trying to get a high reputation for China. Like I said, think it privately but don’t make it obvious to westerns that Chinese people can’t handle globalization!
you don’t goto a foreign country and commit adultery, that’s a ultimate disrespect for the host country, and plus black people don’t have a high reputation in china due to illegal drug dealing and illegal currency exchange. there’s also more than 100,000 illegal blacks in guangzhou you still wonder why chinese discriminate against blacks so bad?
Yippee, come to China but don’t have sex oh and don’t come if you’re from Africa except we’ll come to you and make money off you. But please, don’t buy our guys any beer or wink at them or anything, just hand them money and walk away.
Really respectful.
If there’re a hundred illegal people ANYwhere in China it’s the PAP and Border Patrols’ fault, deal with it!
PAP don’t have any problem rounding up people in Shishou (well in Shishou actually the people rounded up the PAP, but….okay how about Kangding or something) so if there’s – how many – one hundred THOUSAND (??) illegals in GZ, it’s cuz the ZF WANTS them there.
You wanna blame someone, blame the right source.
I agree with SauLaan,
What you don’t know is that organized crime in China is controlled by the locals and a lot of people get benefits. Even, if you want to get involved, YOU MUST GO THROUGH THE LOCALS. So, if someone is committing an illegal crime in China (and making big money), there is a Chinese person involved. I worked in several bars. Although, I wasn’t involved in any illegal engagements. I can say that drug dealing was usually done in a lot of places. Police were given “financial rewards,” every month.
Some Chinese people fail to realize that local governments know and see EVERYTHING! If there are a lot of “illegal blacks in GZ,” they are there for a reason and if they are getting away with drug trafficking, who are they selling it to? CHINESE ARE INVOLVED AS WELL!
I hate it when people use some idiots in GZ, to justify their racism. How about all of the black guys in China that are not drug dealers? I’m sure there are quite a few.
If being an illegal immigrant is a fair reason for being discriminated against, then you’ve just justified all the anti-Chinese comments on here. Those illegal blacks(when was black a nationality) from numerous African countries that reside in Guanzghou might add up to several thousand at most. There are that many illegal Chinese in one city in the US alone. Stick your ignorant head back up your ignorant ass.
You’re not Chinese, so who cares about your opinion?
are you seriously that much of a dick.
You are racist because your eyes are still half closed maybe one day when you guys have the same eye shape(you know like fully opened eyes instead of like someone squinting at he sun)and can see properly then you’ll realise we are all the same oh I forgot you guys have little things.
Welcome to China!
“1. My father is American, not African.”
black people in america = African-American
this dumb bitch just discriminate against her don’t give a shit about her daddy.
But sure lets kick all foreigners out, stop doing business,
and go back behind the Wall, right?
Or…outlaw love?
Time to grow up and join the 21st Century with the rest of enlightened citizens.
sorry man i am grown up, i just don’t buy the multi-cultured crap like rest of you brainwashed folks do.
http://www.dailymail.co.uk/news/article-504354/White-Britons-minority-dozen-towns-30-years.html
aha! The Daily Mail! the well known liberal, intellectual newspapare of choice! Must be true then…
enlightened me more about this love you speak of in your world
Enlightened citizens? Heh, racism is making a comeback in Europe due to non-white immigration; America already has Stormfront and their numbers are growing. We’ll see what happens in eventuality.
The girl is beautiful.
She is beautiful! Can’t sing to save her life but she is quite stunning looking.
Dont know where this fits in, but when wandering through a local craft market in Fuzhou a few years ago, I came upon a copy of Mein Kampf which had been translated into Manadarin. If you want white on black murders, go to St Petersburg.
By the way I support Lou Jing and her mother 100,000%, you guys are despicable to be so stupidly cruel to two fellow citizens. Like YOU’VE never had sex with anyone and couldn’t have gotten pregnant “out of wedlock” [what is this now, Puritan England??? Jesus.]
She’s a beautiful Chinese citizen and I can tell by the way you treat her how you’d treat some so-called “55 minorities” person, probably just as bad. Sigh. Too far to go yet. Please stop embarrassing us in front of the world. You want to be “yesterday,” then yam cha with an older person and grumble about dark-skinned babies while the rest of us emjoy become a superpower with a peaceful rise.
I don’t think a society needs to be Puritan England to look down on adultery and abandonment. I’m not saying the woman and her child doesn’t deserve sympathy – they do. And I’m not saying that it’s fair to blame the girl for her parents’ deeds – it’s not. But this is not simply a case of people being too Puritan, unless you care nothing about family values at all.
Yeah but the only reason anyone cares is because the father was black.
Actually, the reason anyone cares is because she is 1) a celebrity and 2) exotic (so yes, the fact that her father was black does make a difference, but it’s not the only reason).
I doubt it. Adultery is looked down upon by most civilized countries on this planet. But I’ll also say that there’s definitely a double standard in the world.
When men are sluts and go out and FUCK a lot of women, they’re considered “the man” and are respected by other men in society to a certain degree for being able to charm women.
However, when a women does it, she’s a bitch, slut, whore, hoe, especially Asian women where society still has this demand on women here to be pure and free of taint.
There’s definitely other double standards that exist out here as well. Look at Korea where women beating is still more or less socially acceptable or Japan where women just get shit wages and socially acceptable abuse of women is part of society.
Even the US is still sexcist. Women make .70 cents per hour where as the man with the same job would make a dollar.
Let’s face the facts people, this topic is big but not for the right reasons.
Family values?
The world as a whole is losing the battle on this. Look at the typical American family during World War II and look at it now. DISGUSTING . . .
Look at the family value trends happening here in China, especially Beijing and Shanghai where the one offspring per family rule has destroyed some of the young. SPOILED FUCKS who can’t do anything and won’t do anything besides studying.
In my honest opinion, the world needs to bring back good old fashioned ass beatings. Fear and respect are roughly the same thing if you think about it.
“No on is above an ass whooping.”
-Chris Rock
Gotta love Chris Rock (Unless you’re Chinese)!
having a hit at this girl behind the anonymity provided by the internet is something every fu&king person can afford to do. if the chinese want to find out how we regard them in africa then they should listen. just as the N. Koreans see Hilary Clinton to be a funny woman, thats the same way we see the chinese to be funny people but all the same respect them as humans. there are many living here and are well-vexed in fake products and importation of useless stuff into africa. those here are involved in several shady deals and still see themselves to be better than others. but we give them space to breath.
i only blame that idiot of a black man who has brought this insult upon this girl. no wonder he’s from the US.
(\__/)
(=’.'=)
(”)_(”) Down with Racism
You’re the second person that I came across that can do art like this. The other one was a picture of a girl leaning on her hand. Nice.
my teacher once said that literacy doesnt mean education. you may be able to read and write but i dont think you are educated enought to comment on such a delicate issue as this. it is natural for one to defend his/her race but u really need to know that all those stupid news u hear of are just a fraction of africans killing themselves with spoonsorhip money from the western countries. see the kettle call the pot black.
I think at least half of the racist comments come from jealous Chinese girls.
lol you for reals?
go look up the ideal minority, its often written in sociology books.
go look at the majority of people in jail.
look up the stats on who is on welfare.
strong suspect that you are in fact a a black
1.) I was half-joking/half-serious
2.) Ok, there are some black people in jail and on welfare…so what?
3.) How can Chinese people be racist towards blacks while simultaneously adoring the NBA and Kobe Bryant? I don’t understand.
4.) I’m not black, I’m white….who cares?
5.) “Strong suspect that you are in fact” one of the jealous Chinese girls I was joking about.
1) ok
2) Blacks destorys the economy and society, I do not like my tax dollars paying for the baby popping way.
(refer to majority of sociology books, and look up the ideal minority. It states that Asians are the ideal minority in society.)
3)Thats cause the do not have blacks in China causing havoc. Liking them and having them is two different cases.
4)I assume you are either a wigger, or a closet wigger.
5) Sorry ain’t a chick, I am a dude.
I agree that an asian minority in society is probably much better than an asian majority.
Wigger?
Not really….just a white guy from California…more into surf/beach/rock culture.
@ do not want:
“Blacks destroy the economy and society”? Blacks built the American economy and society… without hundreds of years of black people working for free, America would have been nowhere.
Go look up the history of Western subjugation of African, the American slave trade and hundreds of years of prejudice and discrimination. Then have a think about why black people are overrepresented in prison and welfare.
I strongly suspect you have shit for brains.
My parents are Chinese and I can say that she’s hot! ’nuff said.
Wow. So she appears on a TV show where she will be judged on her appearance. And then she doesn’t like it when she is judged on her appearance. Hmmm.
Yeah, okay, she shouldn’t be condemned for her mother’s behaviour, but she surely can’t decide to be judged on her looks and then complain when she is.
Oh and I’m British and not Chinese or of Chinese descent.
she was meant to be judged on her presentation, not racially attacked.
That is just terrible that things like this still exist =O I think China is going through the American phases and they are right now in the 1930-70s. Poor girl who had no decision in what she would be
Good work, CHINASMACK!
Over 200 hits in just a few days.
Nothing will generate traffic better than topics involving Chinese women having sex with foreigners especially if the foreigners are black.
This topic allows every idiot and his mother to make asinine comments regarding blacks – bad; and Chinese women – Chinese women with blacks – very bad.
May I propose a title for your next topic: “Raped Chinese women give birth to Japanese war babies.”
I’m sure this will generate traffic for your site but in inverse proportion to the intelligence of the comments.
“Raped Chinese women give birth to Japanese war babies.”
Can’t wait to read it!
That must be one hell of a long gestation period.
I’m quite surprised by so many Chinese netizens immature view of race. It is instructive how upset so many are about this. Of course extramarital affairs are bad but it’s extremely common in China. It’s only because the father was a foreigner and a black that people seem so upset. What bald racism! The young lady is very beautiful and I hope she doesn’t let the lowlife netizens get her down. If China is too rough on her I hope she will come to the US. We would welcome her.
The only thing I disagree you with, is that the perception of beauty standard is different all over the world. From my understanding, there is a long standing beauty standard in China, and much of the eastern world that lighter skin tone is considered beauty, meanwhile darker skin tone is consider ugly. One of the reason of this is that during imperial time, people with light skin tone are associated as people with office or business jobs. People with dark skin tone are associated as hard labor or farmers who have to work long hours in the Sun. Other asian can back me up on this point.
Therefore, I do not think it is racists for Chinese or other asian to considered dark skin tone as ugly verse light skin tone as beauty. If a man have to have sex with every women of every color just to proof that he is not a racist, then this world will be filled with racists.
PS: I think most of the Chinese netizens were piss that her mother would cheated on her ex-husband with a foreigners, worst of all a black man which in China is considered ugly.
PSS: Even before this story, Chinese perception of black beauty has always been negative. Dark skin tone simplely have never been considered to be a beauty standard. I DARE say that this rule also apply to: south asian, SEA, and even some Arb and latino with dark skin tone. I am not going to lie, racial discrimination is bad. But I dont think dating discrimination is part of racial discrimination. In contrast, plenty of western woman refuse to date asian man. Do we go bitch about it and cry racist?
PSSS: And I do agree with you that she would have a easier life in the US then China due to her skin color.
@ Ming
Point of information.
PS in letters stands for post scriptum, or postscript.
post – prefix – after in time or order
PPS would be post, post scriptum
OMG those girls sing so freaking horribly… JUST MY OPINION but Chinese (actually all tonal languages) are not suitable for singing.
I wonder if this girl can dance though. If she were part Latino, she’d probably sing pretty well. Just listen to some Filipinos sing and you’ll know what I mean.
Seriously, this singing is AWFUL!
The only way this would be American TV (like American Idol) would for people to laugh at and ridicule.
I don’t think most Chinese people can differentiate between what qualifies as good music and what qualifies as shit.
Without a doubt. She is quite beautiful, but can’t sing her way out of a shoe box, but most Chinese or Asians don’t know how to sing or have a clue to what real singing is all about. I am not talking about their traditional music, which they sing quite well, but when they venture into the pop world, like the Japanese(Gawd, awful)the Chinese way of singing pop is over the top unpleasant and annoying is an understatement. Chinese need to overcome their racists, xenophobia fears and work on their singing abilities.
Personally I think tonal languages is great for singing. These girls sings like shit though.
And I’m also sick of all the Chinese bashing on here.
I’ve been here like 20 something years and noone gives a fuck about me. America’s got a personal vendetta against me. Sure, I’m pretty weird and shit but society treats me like some sort of trash. itz total alientation sometimes, I just wanna blow my brains out, except I’m too pussy to go though with it.
I’m sure that someone gives a fuck about you.
You need to throw away all of your emo music!!!
Fike is one angry, unsatisfied being.
Angry and unsatisfied? Why? Because I made a joke about emo music?
Nah, cause u likesy telling peeps what ta do. Usally tis moostly angry und unsatisfied beings qui likesy ta do dat very muchy.
Me thinksy me don’t likesy u anymore. Cutesy ass or no cutsey ass.
Raspberries! Raspberries!
Gaad! Does Google Translate supports the language you are using when you write your comments?
Tried it, to no end, unfortunately. :(
As a side note: According to my Bullshit Detector Device, you are undoubtedly Chinese.
One word (one dream?): Fail
Yipee! Da Grudge wanna join da fun!
What’s a Chinese?
Btw, da Grudge, u a Daily Mail reader? Good fer u.
Sorry, but Chanel Iman is waaaay hotter.
I still can’t over seeing a black chick dressed like a fob.
Just want to say, there are several kinds of people replying to this post.
1. Level headed and rational Chinese
2. Level headed and rational Foreigners
(Some really interesting posts from this group)
3. Racist Chinese
4. Racist Foreigners
(Filed Under Ignore: The usual stupidity)
5. Racist Chinese that pretend to be foreigners that curse Chinese.
6. Racist Foreigners that pretend to be Chinese that curse Foreigners.
(Filed Under Ignore: Only want to make others angry. So, if others are angry and speak without thinking, they can prove a point.)
There are just as much racism in China as in other places in the world. It’s all based on ignorance, period. Most of these people who post these nasty comments probably have never seen a black person, and they form judgement based on what they read in the media, see in the movies, etc etc. The world needs to come together more to eradicate these ignorances.
RE: “Just as much”
Mainland China has significantly more racism than, say, Hong Kong, in my experience – and I’m sure anyone who frequents both will agree.
As some people have mentioned, it’s a very homogenous society, as a result, it’s natural for people to ‘huddle’ with those who look like they do, and persecute the others.
In many cases that I’ve witnessed, Chinese ‘huddle’ mentality goes like this:
Han sees Minority – will single out based on minority.
Han sees Minority and White – will group with minority and single out against White.
Han sees Minority, other Asian, and White – will take the side of other minority, and sometimes against asian & white, or sometimes with other asian against white (depends).
Han sees Minority, White, and Black – will take the side of Whites over Blacks.
That’s the basic “pecking order” from the Chinese perspective’s I’ve witnessed. This is usually a male-only scale.
Han sees Minority, White, and Black – will take the side of Whites over Blacks.
You’re clueless. The smart Chinese person would pit the black against the white. Maybe you’re just hanging around assholes and idiots, since they gravitate to the foreign trash ruining China today.
Foreign trash ruining China today?
LOL!
Shanghai and Hong Kong are two of the best (if not the best) cities in China and they were pretty much built by WESTERNERS.
Oh, and the computer you are using….what role did China play in the invention of the computer (or any modern technology) ??
Wake up and smell reality.
Good points Fike2308, but don’t you think that they were also built on the back of exploitation and slavery?
British ruled HK was essentially a police state, with a curfew enforced during the communist riots. It was only in 1992, five years before the handover, that Patten started democratic reforms which is still a hot topic in HK even now in 2009. I can see the hypocrisy in that, and I’m sure the Chinese can as well. Britain suppresses democracy in HK for almost 150 years, then worrying about their precious subjects, decides to introduce reforms.
As for Shanghai I do agree with you it is perhaps the best Mainland city, in terms of being cosmopolitan and VERY easy to live there for a foreigner.
Also on the computers point agree, first prototype developed in Manchester, England, mass marketed by IBM, first discovery of HTTP by Berners lee, the list could go on…
Nice post.
@ Alan
“Good points Fike2308, but don’t you think that they were also built on the back of exploitation and slavery?”
Probably….I don’t claim to be an expert but what you say sounds reasonable.
Granted, the mother cheating on her husband is bad, I do not condone that, but the child is innocent. I feel so sorry for her, if it was with another chinese/asian man, it wouldn’t be an issue, cuz she would be born with a chinese-like skin tone, even a caucasian male. but because she is dark-skinned, she is the target for insult and racism.
hey I waz just kidding earlier. Now I just find the whole thing funny, the diccusino that is. It’s stupid. This website is stupid. I’m stupid. The internet is pretty stupid. Don’t worry, I will be off soon. My mind is made up. I will still be on the internet but chatting on the internet about random shit–while being put on all sorts of lists–is not my cup of tea.
Really, just read the comments. None of it makes much sense if you read it out loud.
Latest I heard is that is was Obama’s half brother in Shenzhen who’s the Dad.
“Conclusion: Chinese need more genetic material from blacks and whites in them, people always say mixed blood are more beautiful/clever. Its well known FACT.”
Very True.
“Conclusion: Chinese need more genetic material from blacks and whites in them, people always say mixed blood are more beautiful/clever. Its well known FACT.”
WRONG. Half Chinese half white babies have lower IQs, lower wages and lower grades.
http://img36.imageshack.us/img36/1125/gpaandrace.gif
They also are more likely to face depression and other markers of poor health:
http://findarticles.com/p/articles/mi_m0DXK/is_20_20/ai_111529997/
A new study that involved surveying 90,000 adolescent U.S. students showed that those who considered themselves to be of mixed race were more likely than others to suffer from depression, substance abuse, sleep problems, and various aches and pains.
They are also more likely to be obese:
http://scienceblogs.com/gnxp/2008/08/race_mixing_leading_to_obesity.php
It is a well known FACT for Eurasians only.
It is also a well known FACT that mixed with blacks is definitely less pretty.
Even Tiger Woods and other rich black men, himself prefers a pure blonde. Black men has the highest rate of interracial marriage because their own kind is less pretty and desirable on bed compared to bondes/orientals.
You just have to surf the the online forums, black men themselves find their own kind less desirable than whiter races.
What another idiot! is this what you want to believe? well listen well you pink man dolly, I am not proud to say this but I have dated loads of your so called white women and I have made very little efforts (if any) in doing so. Some how in your hollow head it is the so called black men that goes after your women. No you are wrong, everyone knows that it is the other way around. Your women simply can’t take their hands of us strong bronze men. I once had this ‘white girl’ as a friend, she’s always pleaded with me to take her to one of our African parties in London. One day I did, the party was happening downstairs when suddenly I noticed this friend was no where to be found, in the head of the party I found my way to one of the upstairs bedrooms and Whoa! there she was, your ‘white woman’ fully spread eagle on her back, one black on top while four other black waited patiently for their turn. there are thousands of stories of this nature involving your white women. As for your comments on our bronzy women being less attractive, com’on get real can’t you see just as us bronzy men are no BugFu*kers so are our bronzy women no surf boards or flat saucers. Throughout history we’ve never gone looking for you the truth is that it is you lots that always come looking for us.
Racism is born from complete ignorance. So if you are spouting racist comments you simply prove to everyone else that you are not only lack basic education but you know nothing of the world.
People come in all different shades because, surprise surprise, not everyone on this planet looks the same. The hotter the country, the darker the skin will be of the indigenous people because nature determines this.
The only mistakes here are that the mother had the affair whilst married. The only person that should be angry is her husband. It shouldn’t matter what colour skin the guy has, the fact your wife is sleeping with another man is enough. But this is life, things happen, you learn, you move on.
The fact is, she is half chinese and half american and she seems like a very nice girl.
I cant believe how vile and spiteful the chinese people are towards this lovely girl because of nothing more than her beautiful dark skin. It cuts me right to the bone to think this mentality is the majority in china. why am i not surprised? once again china has shown its complete naiveity when faced with something slightly out of the ordinary. What a shame that the pure ignorance of the chinese really shines through here, the saddest thing is that I am not surprised. Once again china, you have shown your cards and let yourselves down (again) with this behaviour. You should all be ASHAMED!
Eh…”China”? Does dat include da Uyghur and da Tibetan hommies? How ’bout da Qiangs, da Mongols, da Manchurians or da Hans? Seeesh!
How about we start lynching you? Shut your mouth and go back to stormfront.
She’s hot! Plain & simple & her mother should be very proud for bringing her into the world. Get over it, you racist bigots!
I agree, her mother should go make more beautiful black/chinese interracial babies.. Since the other one ran away, look for another black guy.
She’s hot! Plain & simple. Her mother should be very proud for bringing her into this world.
Get over it, you racist bigots!
She should have hit those rediculous Spring Festival Shows where laowai get up and make dicks out of themselves. Her Chinese would rock it!!!
Can’t believe the Chinese comments either. I think the chick is chocolate goodness incarnate. Quite the hottie.
Reading comments like these always make me wonder if China can ever be a truly civilized country and join the “1st world”. Too many people here need a serious change of thoughts and I would LOVE to see the government doing their part in changing an incredibly racist mentality running amok.
And another thing: Before you write shaite about other people maybe you chould check how your male family members here in China behaves. I read studies showing that 73 percent of married men have or have had affairs. Maybe it’s worse when it’s a woman doing it.
I also bet the netizens flaming her couldn’t get a woman like that in a million years.
why would Netizens would want her to begin with?
u should be more wise than reading some ” study” about something that you can’t really or truly measure
I read studies showing that 73 percent of married men have or have had affairs.
You’re full of shit.
That fucking goddamn holier-than-thou face on that fucking cunt of a mother of hers…what I would pay to have the chance to smash it clear in with a hammer.
Yes, like you’ve now smashed China’s good image with a hammer. Nice job, everyone.
wtf
SF
you need to grow up and realise that this is the real world. you can’t go around treating people that way!
leave the girl and here mother in peace.
whats done is dones. its times to get efucated and stop your racsist ignorance!!!
Shut your fucking mixed-race trash mouth. What you are really defending is yourself and your own mixed-black heritage. “What’s done is done.” I guess that can apply to anything in life, any action, any crime, anything! So we should just forget about any kind of justice system also, since “what’s done is done”.
In any case, what’s done may be done, but in this particular case, with a bit of prompt action (and balls, which is something Chinese don’t have much of unfortunately), the mistake can still be corrected. Both of these walking piles of human trash should be eliminated not only from Chinese society but from the human race itself.
If only sack-less retards like you would post your street address on here we could find out if you could put your money where your mouth is… doubt it.
well i guess if stupids people have to be eliminated from the face of the earth…there won’t be one chinese left standing.
we all know that chinese are the single,stupidest people on earth.
Oh Mike Fish, you’re so brave and strong, I guess that’s why you posted your address yourself, to show all the “sack-less retards” here a lesson, and to show them who really has a “sack”. We all appreciate you taking a few minutes from lifting your weights for that…I admit some of us do need to be taught a lesson. Oh, but wait. You didn’t? That’s confusing and surprising. Or maybe not.
Morons who resort to “post your address on the internet” in their arguments are among the most pathetic, hypocritical, and outright idiotic trolls on any forum.
Mike Fish: don’t think to presume anything about others…you know absolutely NOTHING, aside from a bit of text on your screen. And above all, don’t think that you’re anything remotely better, tough guy…just the fact that you’d have the cowardice and lack of self-awareness to post something so detached and juvenile proves that you’re just as much a “sack-less retard” as anyone else here, if not more so.
You are funny… always getting all riled up and angry. The difference is, without your anonymity, you could not say what you do without getting a serious pounding, not by me, that wasn’t the threat, but by all the other people you intentionally offend. I didn’t threaten you, why would I? I suggested your personal information might attract some people eager to kick your ass though. I know without a doubt I could say all of my comments on here to the face of the person I’m communicating with. There’d be unanimous consensus on here that you couldn’t.
Still no address. I guess you’ve found your own “sack-less retard”ness after all. Congratulations. Nothing but troll trash and a coward also, as expected.
Your level of intelligent articulation highlights that your not even ignorant just outright full knowingly a ruthless, racist, utter dick, pyscho. The fact that you are informed and still choose to be this way shows you must be the the most stupid muther fucker on the face of this planet.
I guess your mother lost her virginity to a black man as well that’s why your hate this lady so much.
or because you’re so ugly so gross u can’t even dream of having any other girl than a chinese girl…
now you’re jealous that even blacks that u hate so much can get more action than u in your country.
ohhh did i hurt your little feelings???
well too bad that’s how it is around here.
and you’re not ugly and gross then prove me wrong and post your picutre….
you know too well u can’t compete with a black for any girl of any race….u must be pretty pissed.
I bet a chinese girl will choose a black guy over you a 100 times.
Who the fuck are you. That’s the second time you’ve left a comment and it’s been ruthless and repulsive. Why don’t you just fuck off and die.
The very fact that a Chinese girl with dark skin makes news, proves how far China has to go to catch up with the world :(
Like I said, you should keep these thoughts private, but it’s too late–now everyone can see that the Party’s talk of “56 harmonious ethnics” is completely fake.
Also apparently someone is only a citizen until they have dark skin; then national unity doesn’t matter one bit.
Dude are you stupid or what? The entirety of Southeast Coastal China used to look like that mixed race girl. Probably not as pretty, but the complexion was the same.
the very fact you are all commenting on this, that this thing exists, is damn lame.
Actually, I think it’s mainly the expats and English language China sites that are making this into news and their cause celebre. Hmmmm, fascinating…
I want to make black-chinese babies too!!!!
isn’t that a racist theme statement ?
No, people have the right to choose who to have sex with. As long as you want to bump that trunk and it’s consensual. More the power to you!
Unless he was being sarcastic. Then he’d be a complete ass . . .
Well, she is indeed a lovely girl, and I suspect she may have a bright future.
Indeed, I hope she does.
Just wish she was a little older…
She has a great future… just not in singing. Her voice is HIDEOUS.
ever wonder its always a black guy and chinese gal?
if this girl was product of reverse gender pairing would outcome be the same?
I would like to know whether the issue is that her mother had an affair? or that her mother had an affair with a black man? EITHER WAY IT IS DISCRACEFUL THAT ONE WOULD DICRIMINATED AGAINST THIS POOR GIRL FOR EITHER REASON!!!!
My grand mother was born to a black (Guyanese) woman and Chinese father; WWHO WHERE MARRIED!!! We have always been quite proud of our Chinese heritage and I myself have even made steps to learning more about chinese culture. I have not only visited China but, I also take weekly Chinese manderin lessons.
Hearing about the racism which has been aimed at Lou Jing has deeply saddened me. On my visit to China (where I had hoped to one day live) I experienced no racism from the chinese people. Infact I recieved quite a warm welcoming. Therefore I was deeply shocked by the hatred shownb towards Lou Jing.
Why must she be a victim of niave, ignorant racists?
I myself do not agree with infidelity. However, Lou Jing and her mother must not be punished for past mistakes!
Why is it that it is seen as shameful for a chinese woman to have a child with a black man? Many chinese me and women marry white men/women and it is seen as a good thing!
To me, the mixing of different races (black, white, chinese, asian,etc…) is a beautiful thing. Lou Jing is an absoultly stunning young lady. I admire the strength and bravery of her and her mother; no matter what her mothers passed mistakes were.
I feel its time for everybody (not just the Chinese)to get educated about other cultures. This way we can put a stop to ignorant racists!!!
THOSE WHO PUT LOU JING DOWN ABOUT HER HERITAGE SHOULD TAKE A LOOK AT OTHER PLACES AROUND THE WORLD SUCH AS EROUPE, AMERICA, SOTH AMERICA AND THE CARIBBIEAN WHERE PEOPLE CAN BE TOGTHER REGARDLESS OF THE CHARACTER OF THEIR SKIN!!!
I was deeply shocked by the hatred shownb towards Lou Jing.
It’s the internet. White people are even worse, look at amren or stormfront.
In fact the Chinese are the least racist.
THOSE WHO PUT LOU JING DOWN ABOUT HER HERITAGE SHOULD TAKE A LOOK AT OTHER PLACES AROUND THE WORLD SUCH AS EROUPE, AMERICA, SOTH AMERICA AND THE CARIBBIEAN WHERE PEOPLE CAN BE TOGTHER REGARDLESS OF THE CHARACTER OF THEIR SKIN!!!
lol, yeah right.
What an even bigger shock that you yourself are mixed-black. What a complete shock. The loudest, most obnoxious bastards who are so-called “anti-racism” are always in the end really just watching out for their own personal interests and situation.
please, how can a chinese person accuse anyone of looking after their only interest and being selfish.
Hello!!! are u even chinese? selfishness is the trademark of chinese people.
on top of that you can add.. institutionalized corruption called “Guanxi”, biggest liers on earth, cheaters, weaklings, pussies, uneducated, loud, dirty, bad mouth,fake…the list can go on .
The point is not to compare which country is the MOST racist. I have a serious problem with whenever an issue arises in China, the Chinese people do not look within themselves for change but try to mask the problem at hand by comparing themselves to other countries to twist the problem at hand to make themselves look like the lesser of two evils.
I am 100% Chinese American, and to become more tolerant you must first examine yourself, make yourself a better person and exude class by treating others how you would like to be treated.
Nice guys finish last, the meek inherit nothing, etc.
Chinese people are already the least racist on the planet. If they’re too un-racist whites and blacks will simply walk all over them.
No thank you sir.
Where do you get your logic from? Were you dropped on the head as a baby?
Let’s be real here. Most racist people aren’t active/violent/confrontational racists. A lot of racist people are pure cowards who’ll pull this shit behind your back and never in your face, especially in Asian countries.
If you’re expecting someone on the streets to just jump up in your face and yell out, “FUCK YOU MONKEY!” you’re not being realistic. Even in the west where fights/confrontations are more common, this type of behavior is rare.
Forgot to mention that with the convenience of the internet, cowards can hide behind their monitors and just let loose. I doubt any of the guys in this forum are willing to get into a fight on this issue.
especially in “Asian countries”? Right because “Asian” is a culture, not a huge landmass with no cultural or racial meaning.
Japanese people are probably the most openly racist I have ever met, if they don’t like you you will know it. But most of them are nice people.
I meant what I said. Asian cultures are a lot similar than Western cultures. And Western cultures are similar to each other as well.
Think on it a bit.
http://www.nytimes.com/1989/01/08/weekinreview/the-world-china-s-burst-of-rage-a-show-of-racism-and-of-something-more.html
http://app1.chinadaily.com.cn/star/2003/0417/cu18-1.html
It’s sad to see in 2009, that there has not been much progress over these 20 years, since 1989, when it all kicked off in Nanjing.
But I’d take China over South Korea any day, where people spit at you in the street with hostile gazes, just because you are a waygook, and buy into that whole god is Korean bs.
Let the debate go on!!
I’d say many of the people on here spewing their vitriol against “Chinese” only have an enlightened view of race because they were taught it. They likely LEARNED to like black or brown people. They’d be xenophobic bigots if they hadn’t been influenced by their formal education or environment. Without that “education”, most of the blinder-wearing-assholes on here would be just as ignorant and exclusionary as the Lou Jing haters.
On another note, people with one baseless bias usually also have a list of others. I’d say if you dug any deeper, you’d find that the Lou Jing black-haters and the Chinasmack-crowd-China-haters likely have other biases in common… anti-gay, anti-Muslim, anti-Semitic, anti-whatever, whichever bias that hasn’t been educated out of them.
I’d say if you dug any deeper, you’d find that the Lou Jing black-haters and the Chinasmack-crowd-China-haters likely have other biases in common… anti-gay, anti-Muslim, anti-Semitic, anti-whatever, whichever bias that hasn’t been educated out of them.
Difference being in the west we are educated in a multicultural environment. Not much multi cultural of anything in China. Even the Uighurs are not allowed to dorm in with Han students at unis in China, isn’t that a form of hate/islamophobia MF?
Ehhh…you do know that the Han and many other non-muslim ethnic Chinese minorities love their porkies and their booze right? Besides, how do you know that the Uighurs are particularly keen to share with the Han students. Racism and prejudices cut both ways.
Of course in an ideal world with lots of resources for great facilities it would be great for them to be able to share a dorm.
You’re right, the “west” is a veritable paradise of racial harmony, simply because it’s a mixing pot. America especially is just plain racism-free…after all, they elected a (half) black president, didn’t they!
You are a true fucking retard. Like all the other idiots here posting in support of this disgusting animal and her off-colored offspring, under the guise of “tolerance”.
One day you are going to get bashed by some kkk fuckers and only then are you going to realize that racial hatred is not justifiable.
I am from the “KDS”BBS. I want express my opinion to everyone,sorry my poor english .I will try more clearly.
Most comments consider that most chinese people are racist,That is not true.
There is an old adage in china culture,”scandal in family can not show in public”Translate to english is “Don’t wash your dirty linen in public”,adultery is a very big mistake in china tradition.In antiquity china,Women would killed because this mistake. even though in today china,This is still a “dirty linen”.So most chinese consider wash this “dirty linen” in the public is shame on doing.So the bad comments added more and more.
From my side I like this girl,she is beautiful and bravery.I believe this girl will has a beautiful life,But from another side ,I can understood the bad comments.
KDS tourism group comes for mark.
What a great mom, great girl, and a great green hat on her father’s head!
Yeah, like u own this site.
As a black guy reading these posts i have a smile on my face.
Do I think chinese hate blacks? without a doubt
Do I think chinese are picking on black because they can’t do sh*t about whites? without a doubt.
the reason I’m smiling reading these posts is because chinese being racist to blacks doesn’t bother me at all.
Why? because it didn’t stop me from achieving anything i want here in China ( Family,Job,Love,Fun,Travels…)
why? because statiscally i know as a black man i have more chances of achieving international greatness than any chinese can ever dream of achieving.
why? because I know that chinese people have an inferiority complex ingrained into their mind they can never get rid off.
why? because i know everything being equal a chinese person can’t stand a chance competing with a black person and i mean this on any level.
and yes chinese do resent blacks for a lot of other things…blacks have achieved more positions of power worlwide than chinese can dream of.
US presidency, NASA, UN, CEOs of forture 500, Media, Sport, Culture, Charity, Nobel Prize, Research, Religion and so on and so forth.
In any of these categories blacks beat chinese hands down. Tell me one thing that a chinese has done that a black hasn’t done ( space:a black has been there before a chinese, Nobel Prize: a black has done it before a chinese, SPort:no comment, CEOs: No comment, Education: no comment, Media: no comment…..)
that’s why i’m smiling while reading these posts..because i don’t care.
I have all the fun i want here in China while being black and i’m proud of who i am.
I have great chinese friends and i’m proud of them and i ‘ve been respectful of the culture. i don’t pay attention to all the D-Bags out there having a problem with me..because usually they do it behind your back.
so to all you black people out there in china, chin up.
People are different for a reason and enjoy your blackness.
Chinese know that it’s a dog eats dog world out there when it comes to RACES….and since they can’t do squat about whites so they pick on blacks..
but we all know that whites are doing far worst things here in China than blacks are.seriously the way chinese treat white people goes beyond Master and slave relationship.
Chinese literally adore and worship whites..i know because my roommate was white.
No race has endured what blacks have and no one will achieve what they will. Obama is just the beginning.
Just wait till those little countries in Africa get their acts together and i don’t see how they will be stopped.
So if you want to hate a person because of his skin colour well it’s your choice…go ahead and do that. But Remember Karma does exist.
Peace I’m out.
Like most blacks, you have your head so far up your ass that you have no sense of the real world whatsoever. Blacks, better globally than Chinese? That has to be the single most retarded thing spouted on this entire retarded thread. The Chinese might have their problems, but while blacks have been busy throughout history killing each other, sticking branches into anthills for lunch, and getting enslaved due to their oh-so-elevated prowess, the Chinese were busy creating a lot of the cornerstones of asian and now even worldwide civilization, for thousands of years. Absolutely amazing that one would dare show such blatant disrespect for something they clearly don’t have the slightest clue about, but for it to come from the closest thing humanity has to an ape is the real kicker. Go back to the ghetto, sport, and get a second look at your new world order. Moronic dipshit.
Again, the Chinese aren’t perfect, but if one wants to compare them to blacks, they may as well be for all intents and purposes.
hey hey hey…. thats not right.
even if he’s delusional, he’s happy. Although he shouldnt be spreading delusional ignorance to other people.
Just how on earth can you fetus like little creatures think you are better than we Africans? Can you see? OK I know you all have wearied looking eyes but please. Ok you all have big fat heads but little bodies coupled with long arms making you look more like Chimps than human. Do you know that the phrase ‘Simply the Best’ came from our people? Muhammed Ali ‘I am the Greatest!’ Usein Bolt!? many many more. What else for you idiots to be convinced that we are vastly more better! On neutral ground, Very few white girls will date a Chinese man…Urh!! however white girls fight one another to date African guys he-he-he. Now go back into your frying rice
What? Blacks have a better chance of succeeding in life? They’re more respected? Then why are all these Blacks in America bitching and whining about racism all over the world? Are you fuckin’ high?
Yes, the examples you mentioned list a lot of famous black people, but what about the average black person compared to an average Asian? The last time I checked, Blacks have shit ass wages and have morals to match.
So what’s the average Asian family like? Good education, hard working, responsible, respected as a CONTRIBUTING member of society where as a VERY HIGH percentage of blacks in the US need government help and support. Basically beggars without begging and at the same time, DEMAND respect from the very people who feed them and is more prone to breaking the law and inflicting physical violence than any other race on Earth.
Asians have had far more successful empires, inventions, and other accomplishments than blacks have had. The only difference is that they weren’t giving out awards at the time.
Yours is a very Western point of view. Just how much do you really know about Asia?
Proceed and sit back and smile and live in your pitiful existence as the average black in this world continue to beg for assistance from the rest of society and the successful ones being entertainers. Yes . . . be very very proud of yourself and your race’s accomplishments.
ohhhhh it seems i that i hit a nerve. well guess what..with all that shit going around blacks people they’ve still managed to achieve a lot.
oh yeah of course the average chinese family is better off..according to who? your communist party.
we all know the reality in China people are just as poor as you can find anywhere in Africa.
Haha….we all know why chinese turn out to be geeky at school because of their inferiority complex.
because you cant stand shoulder to shoulder to blacks and whites you lock yourself in your basement and do the one thing you think they can’t take away from you.
Seriously,when have you seen a chinese male in social functions doing anything.
nobody takes you seriously. we rather have an asian woman than an asian male.
you guys are just doomed. because you’re little sissies and you all know it.
and all irony aside i rather be a black man than a chinese person any day, anywhere in any dimension a billion times over.
Yes it’s okay for you to live your life in the shadow of others, always claiming you’ve had 5000 years of cultural shit…we’re han ethnics..you can have all that.
but at the end of the day your real contribution to the world is just bunch of yellow useless babies, fake dangerous products and bad habits.
Once again the “nigger” appears before all of us showing us what they’re truly like. Instead of replying by facts, you throw a barrage of useless opinions that smell of penis envy.
Thank you very much for proving my point. And if you knew how to read, the post was Asians, not Chinese.
I’m gonna quote the master here again.
“There are blacks and there are niggers. The niggers have got to go.” – Chris Rock
Loser!
NO,NO, NO! He’s just an Uncle Tom of a brotha who’s been brainwashed by some racist whities to think like them.
He’s just desperate to join their Country Club that’s all.
I like the clear humor of this post. It’s like all of your inner racist has come out. If someone told me blacks are better than chinese. I would call them an idiot. Mainly, race does not exist. There are black people in every country. Secondly, chinese is a Nationality. Not a race. So, it’s like one guy makes some gross generaliztions and you all join. To be honest, im ashamed of everyone today. Also, its easier to make gross generalizations about a lot of things. Don’t fight stupidity with stupidity. It’s… uhh.. Stupid. That’s like someone running into a wall and they you try to do it harder, just to show superiority. ALso, if someone says your “race” is “inferior.” Then you justify there idiocy, by repeating the same thing back at them….
Damn you westerners and your “logic” !!
If the CCP says 2 + 2 = 5 then it MUST BE TRUE!
My TV AND my parents tell me that CHINA IS THE BEST AND WE ARE ALWAYS RIGHT! I LOVE MY COUNTRY!!!!
Her voice sux, completely off-note. But she’s darn hot!
Above is an example of typical comment you should make. It has nothing to do with skin color, who her parents are, what they did whatsoever. It’s disgusting to think how narrow people are when it comes to physical adversity.
Wow who knew that the Chinese were just like the Japanese, you ancestors would truly be ashamed, you’ve become the hateful creatures…
I come from China, I come from Shanghai, China. It is the first time I come here.
This website is extremely stupid. It only find some comments which are not so good. But does not translate positive comments and hortative comments to that girl. Actual most of people around me like this black girl. We encourage her and hopes her could go more far in that show. For most of Chinese people, we only balmed the black girl’s mother. Her activity is unloyal to her Chinese husband, it is not acceptable for a married women to have sex relationship with another man in China, not because he is a balck man or not.
Here for some people who blame Chinese only according to this stupid website’s unilateral translation. I feel sad for you all, you are so naive to belive this stupid website’s news, maybe it is the only way for you to contact China. The view of you is limited, but I am not. At last, China will become more and more powerful in the future. We will come back to the top of the world just like 200 years ago. Let’s go and see !
At last, I find most of the news in this website are unilateral, I do not what does these stupid website editor want. Do you get the money from anti-China fund? What can you hatemonger get?
For the intellectual people, I hope you can communicate with some guys who have been in China, you can know a more real China from them.
Hi Felix,
Great post,this is the best post i’ve read so far on this stupid/racist/lowlife website.
we need people like you.
seriously how can people be so hateful to each other?
Nothing good can come out of this, Nothing.
as humans we better learn to get along because whether we like or not we’re getting closer and closer.
there are actually more chinese living in Africa than Africans living in China.
Instead of promoting harmoney all this website does is sow seeds of evil in people’s heart.
THIS WEBSITE SHOULD BE SHUT DOWN.period.
Don’t worry Felix, as an educated and successful person who’s lived in China for three years, communicated with countless Chinese in their own language, and who has been earnestly praised for ‘understanding China very well’ more times than i care to mention, I do my absolute upmost to communicate the real China to those who haven’t been here before.
I ensure that the majority of Westerners I meet who have a generally positive view of China as a mystical, exciting, booming place with a great future in absolutely zero doubt that its people are the most soulless, brainwashed and DULL people on the face of the earth outwith North Korea, their minds permanently on standby, obsessed with being ‘top of the world’.
Oh, by the way, I’ve particularly enjoyed the fact that the majority of your Taiwanese ‘compatriots’ who I’ve talked to are in utter agreement about this. ‘Brainwashed’, ‘pitiful’ and ‘ignorant’ were all words that I heard used to describe the mindset of the PRC’s inhabitants within 24 hours of arriving in the ROC.
Trash gravitates to white subhumans. For some reason all of the people I met in China were good people.
Then again, as a race of dogfucking illiterate retarded cavemen whites will attract the same in China.
They might be .1% of the population, but that’s still enough to keep the average baigui busy.
Hellofriends is SEXY!
I want to have a gay threesome with you and Gaad!
We can jerk each other off while we sing patriotic songs about how much we love CHINA while stupid laowai men have sex with our Chinese women!
JIA YOU!!!
Isn’t the ROC/TW not brainwashed only because it’s a puppet of the US?
fact her father is black is telling though. China has how many blacks versus native chinese men?
she like most of those shanghai women are chasing after westerner men idol worship. apparently her mother found a black american male, in true chinese female angst since, spite her chinese husband by sleeping with a foreginer and someone who is black
BTW
I am living in USA, and I must say blacks are not exactly racist free here.
You have numerous crimes committed by american blacks against chinese students going to school USA
YOu can google and read about this in web
fact is Asians are still categorized and stereotyped by western media
http://www.amazon.com/Driven-Out-Forgotten-against-Americans/dp/0520256948/ref=sr_1_1?ie=UTF8&s=books&qid=1251958978&sr=8-1
the beginning of racism towards Chinese in early USA
fuck, you people really think you can gauge the average mentality or perception of an entire nation’s views on black people by a couple of postings on bbs forums? a nation where the majority are still rural and don’t have internet access? as a black man, i can attest to ignorance displayed by some uneducated locals or even first generation middle class students. however, it is more ignorance rather than hatred that i’ve felt and that is nothing compared to what i’ve dealt with growing up in boston where you could get your head smashed in just for wandering into the wrong irish section. all these self righteous white people posting in defense of this poor girl, i doubt are truly anti racism or are even angered by the issue. i bet its just another excuse to post racist comments against asians. a lot of you came to china and finally had a very small taste of what its like to be a minority and you’re angered that you’re not treated like the kings you should be or so shell shocked by the little racism that you personally experienced that you lose it and try to cleanse your white guilt (those of you from amerika) by getting into issues like this. look, hate all the chinese you want, just don’t do it under the guise that you are great defenders of us poor negroes. some of you little dickless thin skinned white boys are getting a small taste of what us blacks call “home” or at least the homes you have left for us.
Black is fine to any Chinese. The complex raise more curiosity than other emotions here in China. Adultery is NOT fine. Presenting obvious Adutery with foreign for fame is NOT fine.
We are not racist, we are just not as used to adultery as to some people above.
Great!
All the people could blame others racial discrimination, except USA. Look back to your bloody history!!!
I’m a northern Irish catolic. i cud say wee know a wee bit about discrimination. friends murdered houses and shops firebombed year on year anti-catholic marches supported by the RUC and british army. systamatic discrimination from the top down. but im white so im responsible for slavery and so on.
when i lived in a black neighbourhood, they recognised this immediately and they tried to rob and beat me, sell me fake drugs evry single minute of the day.
i learnt fullwell that it was my fault for being white …..
the world works in a funny way
not haha funny but just plain crap funny. such is life
This is a typical cross-culture situation.
First of all, we have yellow people here. White or black is “laowai”, not our people. A black Chinese is already a shock in conventional Chinese culture, and adultery makes people feeling more…sick. If you wenstern people can not understand that, try to imagine a half-dog-half-human thing as your new neigbhour. No, I do not think the black are any better or worse than yellow, white, pink or purple. Yes, she is a freaking “thing”!
Western: Why these people can not accept yellow-blakc people, they are sick, they areracist!
Chinese: Why these people are not shocked, do they still have ANY moral standard at all? Are they still CIVILIZED HUMAN?!
There is no universal “right” thing. Equality, no-racism, democracy, freedom, lot of sex…these are all western. Surprice? We Chinese like them, just as we like beef and bread. But we eat pork and rice for dinner. Human do not share the same system of right and wrong. Never. Your system or our system of value/right-and-wrong is not better than that in a dog’s society, nor worse. Just different. Judging Chinese from western point of view is just as narrow minded as the extreme racists.
Most of the disparaging comments about the mother say she’s a bitch because she had an extramarital affair with a black man…. not just because she had an extramarital affair. This is racist crap.
Lou Jing, jia you!
BOS Neal,
You are a sub-human idiot. Not because of your race or the circumstances that you were born in, but because you are a racist prick walking abortion. For the sake of decent humans, please go drown yourself.
Good comment, very highly civilized person you are.
Did I mention anything about abortion?
Even in Un-decent Chinese culure, tell people to drown themselves is not so decent. Your “decency” does not even exist in other moral worlds. Is it too hard to understand that?
To the editor of this stupid website, if you want to instigate the hate between Chinese and Westerns. As a Chinese who previous had a good relationship with my wenstern colleague, I say you do a good job!
Some stupid wenstern idiot’s comments extremely change my good memory for foreigners! I need to think again what is my foreign colleague’s real mind even they express a freidly look to me everyday in Shanghai.
If you will let the nonsense spewed by idiots on the internet let you change your mind about people you know and never had a problem with before, you sir, must be a complete moron. Good luck in life!
Get off the internet and get back to reality. Go find a latino expat chick and ask her out on a date or something. Make some Filipinos for China.
I love it how Chinese people speak about China as it’s some kind of living entity on its own. China said, China feels, China thinks, China wish, China…
Herd mentality, One World, One Dream.
Go fuck yourself and rot in hell, CHINA.
H1N1+H1N5 will take care of that, thanks to the brilliant western biologists of this world.
Yeah yellow people die of flue and white people never. Yeah western governments have a stronger control so flue does not spread. Hahaha!
I like it as this, it shows to the Chinese people that foreigner are bunch of haters too base on limited views, so in the future I hope china will not treat nicely to these 老外鬼s.
oh for gods sake, everyone’s an individual and everyone has their own opinions. Just because one person said something, doesn’t mean your “western” friend shares that same opinion.
Haha David Zhou. They hate you. Most likely think some weird shit about you and believe you should die.